Chronic lymphocytic leukemia/small lymphocytic lymphoma (CLL/SLL) is a generally indolent neoplasm of mature B lymphocytes that primarily affects older adults but rarely occurs in adolescents and young adults. We report a case of CLL/SLL in an 18-year-old patient treated with venetoclax, an orally bioavailable BCL-2 inhibitor, in combination with obinutuzumab, a humanized anti-CD20 monoclonal antibody. The patient experienced rapid clinical response and after one year of therapy had no evidence of residual disease by radiographical imaging and bone marrow evaluation. This finite, targeted therapeutic approach is an attractive option for future adolescent patients with CLL/SLL.

Hereditary spherocytosis (HS) is a common inherited heterogeneous hemolytic anemia that is characterized by the presence of spheroidal erythrocytes on the peripheral blood smear. Mutations in ankyrin gene (ANK1) is the most common cause of HS in Northern European populations and Chinese patients but is seen in only 5–10% of Japanese patients. The majority of them are familial mutations inherited in an autosomal dominant form. In this study, a heterozygous ANK1 c.856C>T mutation was identified in a 2-hour-old newborn with severe jaundice using targeted next-generation sequencing (NGS) and Sanger sequencing, and was confirmed to be inherited from his mother.

Tick-borne encephalitis is a neuroinfection caused by the Tick-Borne Encephalitis Virus. It is transmitted primarily by tick bite and rarely because of consuming raw milk. It has been discovered in the 1930s. The disease covers the Euro-Asia region which also known as the tick-borne encephalitis belt. It is prevalent in most parts of Europe. The top affected parts of Europe include Southern Germany, Switzerland, the Czech Republic, Austria, Slovakia, Hungary, the Baltic countries, Slovenia, Poland, parts of Scandinavia, and European Russia. Since 2000, in Europe the total number of confirmed cases reported to the European CDC was 51,519. There were signs of decreasing number of cases in 2014 and 2015 however after 2015 a steadily increasing number of cases with involvement of countries which had no history of tick-borne encephalitis. Within Europe, from 1950 to 2006 ticks were prevalent between 600 to 2000 meters above sea level of altitude. The determinant factors for the spread of tick-borne encephalitis are host population size, weather, movement of hosts, altitude, and local regulations on socio-economic dynamics of the local and travelling people around the foci areas. The mean incidence rate of tick-borne encephalitis since 2000 to 2019 in Europe was 3.27 while the age adjusted mean incidence rate was 2.19 per 100,000 population size. The recent increase is mainly associated with human activity as a dominant factor since there are new foci areas with no significant climate change. This review used several articles and data sources from the European Center for Diseases Prevention and Control and Polish National Public Health Institute to examine the trend of TBE across Europe and in Poland in particular.

Fisetin (3, 3′, 4′, 7-tetrahydroxyflavone) belongs to class of flavonoids which is abundant in several fruits and vegetables that we consume daily. Fisetin has manifested several health benefits in preclinical models of neurodegenerative diseases: Alzheimer’s disease, Parkinson’s disease, Huntington’s disease, amyotrophic lateral sclerosis, stroke (both ischemic and hemorrhagic), traumatic brain injury and age-associated changes (physiological and pathological). The main aim of this present paper is to evaluate the role of fisetin in treating several neurological diseases which is attributed to its simultaneous targeting of various molecular pathways. This review provides a comprehensive mechanistic pathway’s pertaining to fisetin role in treating several neurological and neurodegenerative diseases.

Background and Purpose: Rivaroxaban as an oral anticoagulant is widely used for the prevention and treatment of thromboembolic disease. Previous studies revealed cytochrome P450 (CYP)–mediated metabolism of rivaroxaban mainly involves CYP2J2 and CYP3A4. Imatinib, sunitinib and gefitinib are three tyrosine kinase inhibitors (TKIs) that are extensively applied for anti-cancer therapy. Statistical research has shown cancer patients are at approximately 4-7–fold higher risk of vein thromboembolism than normal patients. Therefore, rivaroxaban and TKIs have a profound combination foundation. This study aimed to comprehensively assess the combination safety of rivaroxaban with TKIs in vitro. Experimental Approach: First, the inhibitory activity of the three TKIs was screened. Second, to comprehensively evaluate their inhibitory potential, the reversible and mechanism-dependent inhibitory kinetic constants of three TKIs on CYP2J2 and CYP3A4 were determined. Docking simulation was used to explore the molecular mechanism. Finally, drug-drug interaction (DDI) risks of the combination were assessed using pharmacokinetic data of cancer patients. Key Results: Imatinib and gefitinib exerted significant reversible inhibition of both CYP2J2 and CYP3A4, while sunitinib only showed reversible inhibition of CYP3A4, not CYP2J2. Three TKIs also showed time-dependent inactivation of CYP3A4 and slightly on CYP2J2. Notably, sunitinib had a significantly stronger inactivation effect on CYP3A4 than the other TKIs, with a 4.14-fold IC50 shift. Imatinib was predicted to cause a 114–244% increase in rivaroxaban exposure. Conclusion and Implication: Imatinib showed the strongest inhibition, which was predicted to have a moderate DDI risk. These results provide evidence for medication guidance when combining rivaroxaban with TKIs.

A document by Benjamin Carter. Click on the document to view its contents.

Background: Coronavirus disease 2019 (COVID-19) is a pandemic with no specific drugs and high fatality. The most urgent need is to find effective treatments. We sought to determine whether pirfenidone treatment might reduce the death risk of COVID-19 patients. Methods: Clinically confirmed COVID-19 cases at Tongji Hospital, Wuhan, China from January 29, 2020 and April 27, 2020 were identified from electronic medical records. Information on their demographics, history of coexisting diseases, and therapies during hospitalization were extracted. Based on whether taking pirfenidone during hospitalization, patients were categorized into non-pirfenidone group and pirfenidone group. The patients were further matched using propensity score analysis. Results: In this retrospective study, about 59 patients were treated by pirfenidone during hospitalization and 59 patients with non-pirfenidone were matched. Compared with patients without pirfenidone therapy, patients with pirfenidone therapy showed a better clinical outcome and a decreased mortality (1.7% [1/59] vs. 32.2% [19/59]; p<0.001). In terms of chest computed tomography (CT) images, the ground-glass opacity (GGO)/consolidation signs were obviously absorbed in the pirfenidone treated patients before discharge compared with patients on admission. Moreover, the level of interleukin (IL)-6 and IL-2 receptor were reduced on day 3 after pirfenidone treatment. Moreover, there was a trend that patients with pirfenidone therapy had lower levels of IL-1β, combined with lower hs-CRP, lymphocytes, LDH and NT-proBNP on day 3 after pirfenidone administration. In addition, patients with pirfenidone therapy had higher serum albumin level on day 3 after pirfenidone administration.Conclusion: COVID-19 patients could benefit from the pirfenidone therapy during hospitalization.

Key Points: • The use of drills in endoscopic rhinosurgery allows for precise, safe and rapid removal of solid bone in standard procedures such as dacryo-cysto-rhinostomia and has become indispensable in complicated surgical interventions such as median maxillectomy • Conventional otologic drills are often used as they are readily available, economical and very robust in use • Injuries caused by the rotating shaft of the burr are rare yet it can represent a serious complication following drilling procedures in extended endonasal surgery • The use of low-cost, reusable otology speculum eliminated this complication of nasal entrance lacerations throughout our institution to this date • As a simple safety measurement, we can recommend the application of ear speculum as a reliable protection against drill related nasal entrance laceration

Background: The clinical phenotype of PHPT changed from overt bone and renal involvement to asymptomatic hypercalcaemia. Patients with symptomatic hyperparathyroidism should be referred for surgery, and asymptomatic patients’ management have still a clinical bias. Clinical variability can be linked to specific mutated gene including CDKN1B. Material-Methods: In this prospective study 80 patients (66 women and 14 men, mean age 50.8 ± 12.01 years) with PHPT were enrolled between 2018 and 2020. Biochemical and clinical information were collected on patients’ sex, age, biochemical examination and radiological findings (nuclear 99 mTc sestamibi scans scintigraphy, cervical ultrasound). CDKN1B sequencing, and DNA isolation was performed by using GeneMATRIX Quick Blood DNA Purification Kit. Selected primer of CDKN1BF (rs786201010, c.-456_-453delCCTT) (CAGGTTTGTTGGCAGCAGTA) and CDKN1BR (rs786201010, c.-456_-453delCCTT) (GGAGCCAAAAGACACAGACC) were amplified by polymerase chain reaction (PCR) (Solis Biodyne, Estonia). Results: 22 of all patients were also symptomatic. Serum calcium and 24-hour calcium excretion were significantly increased in patients with symptomatic PHTP (p = 0.009, p = 0.00). Serum PTH levels were similar between the two group (p = 0.667). With regards to classical manifestations of PHPT, bone diseases (p = 0.04) and nephrolithiasis (p = 0.03) were more common in patients with symptomatic PHPT. CC genotype was detected in all patients with PHPT in rs786201010. c.-456_-453delCCTT was not detected in any patients. Conclusion: We emphasized that patients with symptomatic PHPT had more increased serum calcium levels and calciuria. Independent of PTH levels, clinical signs and symptoms could be related with serum calcium parameters in these patients.

A probabilistic approach is developed for the exact solution u to a determinist partial differential equation as well as for its associated approximation u(k)h performed by Pk Lagrange finite element. Two limitations motivated our approach: on the one hand, the inability to determine the exact solution u to a given partial differential equation (which initially motivates one to approximating it) and, on the other hand, the existence of uncertainties associated with the numerical approximation u(k)h. We thus fill this knowledge gap by considering the exact solution u together with its corresponding approximation u(k)h as random variables. By way of consequence, any function where u and u(k)h are involved as well. In this paper, we focus our analysis to a variational formulation defined on Wm,p Sobolev spaces and the corresponding a priori estimates of the exact solution u and its approximation u(k)h to consider their respective Wm,p-norm as a random variable, as well as the Wm,p approximation error with regards to Pk finite elements. This will enable us to derive a new probability distribution to evaluate the relative accuracy between two Lagrange finite elements Pk1 and Pk2, (k1 < k2).

There are few numerical analysis results for semi-linear stochastic delay dif- ferential equations driven by G-Brownian motion(G-SLSDDEs). This paper is concerned with the numerical solutions of the G-SLSDDEs to fill this gap. In this paper, existence and uniqueness of exact solutions of semi-linear stochastic delay differential equations driven by G-Brownian motion are studied first, some suitable conditions for the mean-square stability of the exact solution are also obtained. Then the numerical approximation of exponential Euler method for semi-linear stochastic delay differential equations driven by G-Brownian motion is constructed, the convergence and the stability of the numerical method are studied. It is proved that the exponential Euler method is convergent with the strong order 1/2 and the exponential Euler method can reproduce the mean- square exponential stability of the analytical solution under some restrictions on the step size. Finally, numerical experiments are presented to confirm the theoretical results.

In this paper, we consider the nonstationary magnetohydrodynamic coupled heat equation through the well-known Boussinesq approximation. The second order backward difference formula is used for time derivative terms, and the mixed finite method is used for spatial discretization, we employ the Taylor-Hood elements to approximate heat and Navier-Stokes equations, N$\mathrm{\acute{e}}$d$\mathrm{\acute{e}}$lec edge elements are used to approximate the magnetic induction. The divergence free conditions are weakly satisfied at the discrete level. Due to the use of N$\mathrm{\acute{e}}$d$\mathrm{\acute{e}}$lec edge element, the proposed method is particularly suitable for problems defined on non-smooth and multi-connected domains. Moreover, the numerical scheme is energy conserving. Under the weak regularity hypothesis of the exact solution, we present error estimate for velocity, magnetic variable and temperature. Finally, the convergence analysis is verified by some experiments, and the magnetic fluid phenomenon is simulated by driven cavity flow.

Introduction: The aim of this study was to describe the morphology of the right atrioventricular valve (RAV) and determine its spatial position in relation to selected structures of the right atrium. Methods and Results: We examined 200 randomly selected human adult hearts. All leaflets and commissures were identified and measured. The position of the RAV was defined. 3-leaflet configurations were present in 67.0% of cases whereas 4-leaflet configurations were present in 33.0%. Valves with four leaflets have significantly larger perimeter (119.2±11.1 vs. 109.3±11.3mm, p=0.001). No significant difference was found in superior leaflet length and height between 3- and 4-leaflet RAVs. Septal and mural leaflets were both significantly shorter and higher in 4-leaflet than in 3-leaflet RAVs. Significant domination of the muro-septal commissure in 3-leflet valves was noted. The supero-septal commissure was the most stable point within RAV circumference, with no difference in its position between 3- and 4-leaflet valves. In 3-leaflet valves the muro-septal commissure was placed within cavo-tricuspid isthmus area in 52.2% of cases, followed by the right atrial appendage vestibule region (20.9%). In 4-leaflet RAVs, the infero-septal commissure was located predominantly in the cavo-tricuspid isthmus area and infero-mural commissure was always located within the right atrial appendage vestibule region. Conclusions: The RAV is a highly variable structure. The supero-septal part of the RAV is the least variable component, whereas the infero-mural is the most variable. The number of detected RAV leaflets significantly influences the relative position of individual valve components in relation to right atrial structures.

Postcardiac injury syndrome (PCIS) is commonly seen complication caused by radiofrequency catheter ablation (RFCA) of persistent atrial fibrillation (persAF). We describe a rare case of PCIS with severe pulmonary hypertension (PAH) accompanied by severe tricuspid regurgitation (TR) following RFCA for persAF.

Background: Studies have shown that increased body weight and obesity may be associated with an increased risk of arrhythmic events. However, studies conducted in patients with implantable cardioverter-defibrillator (ICD) have found that low body mass index (BMI) is associated with higher mortality. The aim of this study is to evaluate the effect of obesity on the risk of arrhythmic events, hospitalization and death in patients receiving ICD therapy for primary or secondary prevention. Methods: The study was designed as a single-center prospective and observational. Patients with BMI <30 kg/m2 were classified as non-obese and patients with ≥30 kg/m2 as obese. The primary endpoints were all-cause mortality, cardiac mortality, and cardiac rehospitalization. Results: Among the total of 340 patients, 78.2% were male, 21.8% were female, and the mean age of the patients was 60.9 years. Among all patients, there were 30.6% normal weight, 47.4% overweight and 22.1% obese patients. AF recording was significantly higher in obese patients compared to the normal weight patient group (p=0.02). Shock, appropriate shock, and liquid load sensing were statistically higher in obese than non-obese patients (p = 0.042, p=0.011 and p=0.007). In the primary prevention group, all-cause mortality and cardiac mortality rates were lower in the obesity group (p=0.022, p=0.037). Conclusion: Our findings showed that although cardiac arrhythmic events are more common in obese patients, mortality and hospitalization events are less common in obese patients. These findings are consistent with the reverse epidemiology that has been demonstrated previously between obesity and mortality.

Human populations, especially European, are polymorphic in the RHD gene. A significant fraction of their members carries two copies of a mutated (deleted) allele, which results in their Rh-negative blood type. Theoretically, this polymorphism should be unstable. Carriers of the less frequent allele are penalized by reduced fertility because of the immunization of Rh-negative mothers by their Rh-positive babies, which results in hemolytic disease of newborns in their subsequent progeny. For about 90 years, some form of balancing selection has been suspected to sustain this polymorphism. Several recent studies showed that the Rh-positive heterozygotes express higher viability than both types of homozygotes. However, the genotype of subjects in these studies was estimated only by indirect methods. Here we compared the physical and mental health of 178 women and 86 men who were directly tested for their Rh genotype. The results showed that Rh-positive homozygotic women had worse and Rh-positive homozygotic men better physical health than Rh-negative homozygotes; the difference between Rh-negative homozygotes and heterozygotes was not significant. Our results confirmed that health of Rh-positive heterozygotes and homozygotes differ. Therefore, any result of the comparison of subjects with Rh-positive and Rh-negative phenotype depends on the heterozygote-to-homozygote ratio in the Rh-positive sample. It is, therefore, crucial to analyze the effects of Rh-genotypes, not phenotypes in future studies.

Objective: To evaluate the factors associated with the consumption of drugs without scientific evidence in patients with mild COVID-19 infection in Peru. Methods: Analytical cross-sectional study in a Peruvian population. Patients older than 18 years of age and with a history of mild COVID-19 disease were included. Factors associated with drug consumption were evaluated by Poisson regressions with robust variance adjustment using the bootstrapping resampling method. Results: Of 372 included participants with history of COVID-19 (75% young, 60% female), 72% consumed some medication without scientific evidence, with antibiotics (71%) and ivermectin for human use (68%) being the most commonly used. Factors associated with the consumption of drugs to treat mild COVID-19 infection were thinking that the drugs are not effective (PRa:0.55; 95% CI:0.41-0.74) and not being informed about the efficacy of the drugs (PRa:0.48; 95% CI:0.36-0.65). When evaluating the consumption of the most commonly used drugs, thinking that they are not effective and not being informed about their efficacy were associated with lower consumption of both antibiotics and ivermectin. Likewise, belonging to the lower social class and residing in the jungle region were associated with higher consumption of antibiotics and ivermectin, respectively. Conclusion: More than 70% of the participants reported some consumption of medications to treat mild COVID-19 infection, with antibiotics and ivermectin being the most commonly used. Thinking that medications are ineffective and being uninformed on the subject were associated with lower medication consumption.

Rational, aims and objectives: Our study aims to assess attitudes, knowledge and influenza vaccine uptake of school teachers and the intention to uptake influenza vaccine as well as the COVID-19 vaccine and to identify factors associated with vaccine acceptance during the COVID-19 pandemic in Greece. Methods: A cross-sectional online survey was conducted among school teachers in the area of Western Greece from June 2020 to August 2020. A self-administered questionnaire was distributed via an internet-based link along with an invitation email. Results: Responses from 399 participants were retrieved. 139 (34.8%) had received the annual influenza vaccine in the season 2019-2020 whereas 215 (53.9%) stated that they would get it in the forthcoming season 2020-202(p < 0.001). 152 (38.1%) intent to get the COVID-19 vaccine when available. For COVID-19 vaccine factors that were independently associated with the intention to uptake included more than 15 years at work (p=0.001), prior influenza vaccine uptake (p=0.003), believing that COVID 19 vaccine should be mandatory (p=0.04) and that school teachers are a high-risk group for COVID-19 (p=0.001). Conclusion: The COVID-19 pandemic appeared to have an impact on the intention of school teachers to get vaccinated for influenza. The low level of COVID-19 vaccine acceptance intention amongst the teachers in our cohort warrants further attention. Public health interventions should aim to increase knowledge on both influenza and COVID-19 and prevention of them via immunization in this particular at-risk population.

Objectives To study clinical and echocardiographic parameters in TDT patients, correlating these indices with T2*CMRI. To identify a deformational imaging metric in LMIC with severe TDT, to allow for early T2*CMRI. Background TDT requires lifelong transfusions, increasing the risk of multi organ dysfunction from iron toxicity. The problem is amplified in LMIC where access to resources maybe scarce, delaying timely chelation. T2* imaging is the gold standard to non-invasively estimate myocardial iron, to guide therapy. In resource constraints areas, we propose the use of Speckle Tracking Echocardiography (STE) to prioritize those with severe disease to obtain early T2* CMRI. Methods Twenty-five TDT patients who had undergone clinical, echocardiographic and CMRI evaluation were included in the study. Age matched controls with only echocardiographic data were recruited. Spearmans correlation was used to correlate echocardiographic indices of ventricular function and strain with T2*. Differences among patients with severe disease i.e. T2*<10 vs the remaining TDT group and controls was analyzed using Mann-Whitney U test. Results STE showed moderate inverse correlation with T2*CMRI for GLS and various indices of regional strain. GLS and regional strain were lower in patients with severe disease (T2* <10) when compared with normal controls and the rest of the TDT positive group (T2* >10) Conclusions Early decrease in GLS and regional strain, can serve as a useful tool to stratify those patients at risk of severe iron overload before systolic dysfunction ensues, serving as an adjunct in LMIC to prioritize T2* CMRI analysis for intensification of chelation therapy.

Background: We previously proposed the whey protein beta-lactoglobulin (BLG) loaded with iron-siderophore complexes as the active principle in the farm protective effect against allergies. A lozenge as food for specific medical purposes (FSMP) was formulated to assess its therapeutical efficacy in BALB/c mice and in-vitro experiments. Methods: Binding of iron-catechin into BLG was confirmed by spectroscopy and docking calculations. Serum IgE binding of children allergic to milk, or tolerating milk, was assessed to loaded (holo-) versus empty (apo-) BLG and for human mast cell degranulation. BLG and Bet v 1 double-sensitized mice were orally treated with the lozenge or placebo, and immunologically analysed after systemic allergen challenge. Human PBMCs of pollen allergic subjects were flow cytometrically assessed after stimulation with holoBLG in conjugation with catechin-iron complexes as ligands in a dietary supplement or with the apoBLG. Results: One major IgE- and T cell epitope were masked by catechin-iron complexes, which impaired IgE binding of milk allergic children and degranulation of mast cells. In mice, only supplementation with the lozenge reduced clinical reactivity to BLG and Bet v 1, promoted Tregs, and suppressed antigen presentation. In allergic subjects, stimulation of PBMCs with holoBLG led to a significant increase of intracellular iron in circulating CD14+ cells with significantly lower expression of HLADR and CD86 compared to their stimulation with apoBLG. Conclusion: The FSMP lozenge targeted antigen presenting cells and dampened immune activation in human immune cells and allergic mice in an antigen nonspecific manner, thereby conferring immune resilience against allergic symptoms.

Background: There is an urgent need to assess the levels of protection generated by natural infection or SARS-CoV-2 vaccines, especially in individuals professionally exposed. Measuring T-cell responses may complement antibody tests currently in use as correlates of protection. Our aim was to assess the feasibility of a validated assay of T-cell responses applicable to large number of samples. Methods: Twenty health-care-workers (HCW) were included. Antibody test to SARS-CoV-2 N and S-proteins in parallel with a commercially available whole-blood-interferon-gamma-release-assay (IGRA) to S-peptides and two detection methods, CLIA and ELISA were determined. Results: IGRA test detected T-cell responses in naturally exposed and vaccinated HCW already after first vaccination dose. The correlation by the two detection methods was very high (R>0.9) and sensitivity and specificity ranged between 100 and 86% and 100-73% respectively. Even though there was a very high concordance between antibody and the IGRA assay in the ability to detect immune response to SARS-CoV-2, there was a relatively low quantitative correlation. In the small group primed by natural infection, one vaccine dose was sufficient to reach immune response plateau. IGRA was positive in one, with Ig(S) antibody negative vaccinated immunosuppressed HCW illustrating another advantage of the IGRA-test. Conclusion: Whole-blood-IGRA-tests amenable to automation and constitutes a promising additional tool for measuring the state of the immune response to SARS-CoV-2; they are applicable to large number of samples and may become a valuable correlate of protection to COVID-19, particularly for

Asthmatics are at an increased risk of developing exacerbations after infection by respiratory viruses such as Influenza virus (IV), Parainfluenza virus, and Human and severe acute respiratory syndrome Coronaviruses. Asthma itself, mainly when poorly controlled, is an independent risk factor for pneumonia. A subset of Asthmatics can have significant defects in their innate, humoral, and cell-mediated immunity arms, and it may explain the increased susceptibility to infections. With the current COVID 19 pandemic affecting millions of people worldwide and with mortality several times that of seasonal Flu, it was necessary to revisit this subject. The pathogenesis of SARS-CoV-2, the virus that causes COVID 19, can potentiate the development of acute asthmatic exacerbation with the potential to worsen the state of chronic airway inflammation. The relationship is evident from several studies that show asthmatics experiencing a more adverse clinical course of SARS-CoV-2 infection than non-asthmatics. Recent studies show that Dexamethasone significantly decreased mortality among admitted COVID 19 patients. However, the benefit of inhaled corticosteroids, especially in asthmatics, is still inconclusive. Hence, while we are waiting for more studies that further narrates the association between COVID 19 and Asthma, individualizing asthmatics management among clinicians is crucial to achieving adequate disease control.

Dispersal abilities play a crucial role in shaping the extent of population genetic structure, with more mobile species being panmictic over large geographic ranges and less mobile ones organized in meta-populations exchanging migrants to different degrees. In turn, population structure directly influences the coalescent pattern of the sampled lineages, but the consequences on the estimated variation of the effective population size (Ne) over time obtained by means of unstructured demographic models remain poorly understood. However, this knowledge is crucial for biologically interpreting the observed Ne trajectory and further devising conservation strategies in endangered species. Here we investigated the demographic history of four shark species (Carharhinus melanopterus, Carharhinus limbatus, Carharhinus amblyrhynchos, Galeocerdo cuvier) with different degrees of endangered status and life history traits related to dispersal distributed in the Indo-Pacific and sampled off New Caledonia. We compared several evolutionary scenarios representing both structured (meta-population) and unstructured models and then inferred the Ne variation through time. By performing extensive coalescent simulations, we provided a general framework relating the underlying population structure and the observed Ne dynamics. On this basis, we concluded that the recent decline observed in three out of the four considered species when assuming unstructured demographic models can be explained by the presence of population structure. Furthermore, we also demonstrated the limits of the inferences based on the sole site frequency spectrum and warn that statistics based on linkage disequilibrium will be needed to exclude recent demographic events affecting meta-populations.

• This is a retrospective case series study examining the role of salvage intratympanic steroid injections (ITS) in patients presenting with idiopathic sudden sensorineural hearing loss (SSNHL) following poor response to initial oral steroid treatment. • Pure tone thresholds were reviewed pre-treatment, post oral steroid therapy and 6 weeks post ITS. • After oral steroid therapy alone, there was a mean average threshold change of 6.2dBHL (range of -13.8dB to 33.8dB). This was found to be statistically significant with severely affected patients (defined as average presenting threshold >71dB). • The mean average threshold improvement post-ITS therapy was 2.9dB (range of -22.5dB to 61.3dB), this was not found to be statistically significant. • Some patients experienced moderate improvement following ITS therapy, however no specific subgroup was identified to benefit more from ITS therapy.