Programmed to retain active responsivity to environmental stimuli, diverse types of synthetic gels have been attracting interests regarding various applications, such as versatile elastic biodevices. In a different approach, when the gels are made of tissue-derived biopolymers, they can act as an artificial extracellular matrix (ECM) for use as soft implants in regenerative medicine. To explore the physical properties of hydrogels in terms of statistical thermodynamics, the mean-field Flory-Huggins-Rehner theory has long been used with various analytical and numerical modifications. Here we suggest a novel mathematical model on the volume phase transition of a biological hybrid gel that is sensitive to ambient temperature. To mimic acellular soft tissues, the ECM-like hydrogel is modeled as a network of biopolymer chains, such as type I collagen and gelatin, which are covalently crosslinked and swollen in aqueous solvents. Within the network, thermoresponsive synthetic polymer chains are doped by chemical conjugation. Based on the Flory-Huggins-Rehner framework, our model phenomenologically illustrates a well-characterized volume phase behavior of engineered tissue mimics as a function of temperature by formulating the ternary mixing free energy of the polymer-solvent system and by generalizing the elastic free energy term. With this formalism, the decoupling of the Flory-Huggins interaction parameter between the thermoresponsive polymer and ECM biopolymer enables deriving a simple analytical equation for the volume phase transition as a function of the structural and compositional parameters. We show that the doping ratio of the thermoresponsive polymers affects the phase transition temperature of the ECM-like gels.

Erosion and sedimentation has a serious problem over the year especially in semi arid where soil is loose and in addition torrential rainfall. The need to develop a specissessment of rainfall induced soil erosion and sediment yield model is necessary.. Data was collected between 2018&2019 which was used to develop a dimensionless model for predicting Rainfall-induced erosion using the dimensional analyses approach. Factors used include; Soil infiltration rate, Soil erodibility factor, Hydraulic shear stress, Soil grain diameter, Depth of tilt Mean diameter of raindrop, Rainfall intensity, Rainfall duration, Gully size, and Density of soil Runoff velocity.The model produced reasonable predictions relative to field measurements with coefficient of determination R²of 0.768, the variables in the model are easily measurable; this makes it better and easily adoptable. It is recommended to use locally developed model using specific local data.

The present work aims to investigate the effect of strain reversal during High Pressure Torsion (HPT) on the evolution of microstructure and hardness properties of Aluminium-Magnesium (Al-2.5%Mg) alloy. For this purpose, Al-2.5%Mg alloy was subjected to monotonically (CW) and strain reversal (CW-CCW) deformation by High Pressure Torsion (HPT). The samples were subjected to a series of rotations in monotonically and strain reversal deformation with same equivalent strains of 1, 4, 12, 24 and 60 under an applied load of 6 GPa and with 1 rpm under quasi-constrained conditions. It was observed that Al-2.5%Mg when subjected to different routes, follows same trend in the evolution of the ultrafine structure, i.e. initial recrystallized microstructure with large grain size throughout the disk, at low strain level sub grains with prominent LAGBs network inside the grains and ultimately at the higher strains ultrafine microstructure throughout the disk characterized by equiaxed grains separated by HAGBs. The only exception to this was observed in case of Al-2.5%Mg during high strains at the centre regions where the fraction of HAGBs was found strikingly less as compared to its counterpart during strain reversal deformation. Hardness homogeneity was not observed for Al-2.5%Mg where the hardness at the centre regions was observed to be lesser than the edge regions with exceptionally less hardness at centre for strain reversal specimens at higher strains.

As digitilisation is being applied in redefining products and business models world-wide, evidence abound in the construction industry as a sector that is slow to its adoption. While digitilisation tools have been applied in modifying processes/procedures in the global North; a larger percentage of the sector in the global South is yet to be disrupted. For indigenous firms to join the rapid transformation wheel, this study reviews the interrelationship between digitilisation and building information modeling. The study objectives are to examine the prevalence of cultural and strategic capability, evaluate the relationship between cultural orientation and strategic capability as well as predict a model of building information adoption from culture and strategy. The study population was drawn from the list of construction firms registered with the Lagos State Tender board, list of registered construction firms from the Institute and specific listed firms on the internet. Factor Analysis, Correlation and Regression were the adopted statistical tools. The results revealed production; task and goal attainment; information/communication technology; workforce; innovation, learning and knowledge management as well as conflict and dispute resolution as the prevalent cultural orientations. The availability of resources to communicate, interact and collaborate digitally and leadership capability to organise and coordinate digitally are the top two strategic capabilities. Consequently, 3 out of every 5 firms have moderate awareness on BIM implementation. It was concluded that the level of agreement on the adoption of the culture and the strategy did not reflect on the level of BIM adoption model. Since the results revealed that the existing orientation and strategy contribute about a tenth of BIM adoption model; the firms’ leadership need cultural re-orientation from the client angle and from business environment. On strategy, the firms need support from institutions/government on policies that will cushion the effect of the provision of resources for transformation.

Here the interaction of three aptamers with HIV-1 protease has been investigated with the help of molecular dynamics simulations. These simulations lead to precise structural and energetic results. The sequencing of the considered aptamers is AP1 as the aptamer number 1: (CUUCAUUGUAACUUCUCAUAAUUUCCCGAGGCUUUUACUUUCGGGGUCCU), AP2 as the aptamer number 2: (CCGGGUCGUCCCCUACGGGGACUAAAGACUGUGUCCAACCGCCCUCGCCU) and AP3 as the aptamer number 3: (C, U, A, C, and C nucleotides of AP1 were replaced with A, G, G, A, and C to yield AP3). The results of molecular dynamics simulations show that aptamers 2 and 3 are good alternatives to interact with the protease enzyme and to control this enzyme, but in AP2 has somewhat improved the results. The results of MM-PBSA show that although aptamer three as a mutant aptamer has a good affinity with the protease enzyme compared to aptamer one and by impairing dimerization, it disrupts its structural stability and function. However, the results indicate that aptamer 2 is a better inhibitor because it causes a more severe conformational change in the structure of the enzyme.

A document by Rafael Agujetas-Ortiz, written on Authorea.

INTRODUCTION Propagating fronts are characteristic for many physical phenomena. In case of reaction-diffusion-advection processes, these can be combustion or strain fronts. Solutions having large gradients to problems of this type also arise in nonlinear acoustics. Such problems include, for example, the Burgers equation, as well as equations with modular nonlinearity. The stationary reaction-diffusion-advection equations can be used for modelling of wind field distribution in the presence of plant heterogeneity. The domain where the solution has a large gradient is called the internal transition layer. The numerical implementation of solutions to problems with internal transition layers requires a preliminary analysis of the existence conditions and stability. In particular, for the numerical solution of some applied problems, the calculation method for establishing is often used, when the solution of the boundary value problem for the elliptic equation is found numerically as the solution of the corresponding initial-boundary value problem for the parabolic equation over a sufficiently long period of time. To implement this method, information on the asymptotic stability and the domain of attraction of the stationary solution is needed. In this paper, we consider the initial-boundary-value problem for reaction-diffusion-advection equation and the question of its moving front type solution stabilizing over an infinitely large time interval to the solution of the corresponding stationary problem. The existence of moving front solution is investigated in. The existence conditions of an asymptotically stable solution to the stationary problem are known from. To prove the stabilization theorem, in this paper we use the method of upper and lower solutions, which for this class of problems is justified in. The main idea of the proof is to show that the upper and lower solutions of the initial-boundary-value problem on an asymptotically large time interval fall into the attraction domain of the stationary solution. The upper and lower solutions with large gradients in the region of the internal transition layer are constructed according to the asymptotic method of differential inequalities as modifications of asymptotic approximations of the solutions to these problems in a small parameter. A small parameter here is the width of the inner transition layer with respect to the width of the front propagation region. The study conducted in this work gives an answer about non-local domain of attraction of the stationary solution. In addition, an estimate of the time interval is obtained in which the solution of the front type falls into the local domain of attraction of the stationary solution, that is, in fact, the criterion for the numerical solution stationing.

We introduce a neural field equation with a neuron-dependent Heaviside-type activation function and spatial-dependent delay. The basic object of the study is represented by a Volterra Hammerstein integral equation involving a discontinuous nonlinearity with respect to the state variable that is both time- and space-dependent. We replace the discontinuous nonlinearity by its multi-valued convexification and obtain the corresponding Volterra Hammerstein integral inclusion. We investigate the solvability of this inclusion using the properties of upper semi-continuous multi-valued mappings with convex closed values. Based on these results, we study the solvability of an initial-prehistory problem for the former neural field equation with the Heaviside-type activation function. The application of multi-valued analysis techniques allowed us to avoid some restrictive assumptions standardly used in the investigations of the solutions to neural field equations involving Heaviside-type activation functions.

A document by Ghazala Yasmin, written on Authorea.

We consider three different diffusion processes in a system with a thin membrane: normal diffusion, classical subdiffusion, and slow subdiffusion. We conduct the considerations following the rule: {\it If a diffusion equation is derived from a certain theoretical model, boundary conditions at a thin membrane should also be derived from this model with additional assumptions taking into account selective properties of the membrane}. To derive diffusion equations and boundary conditions at a thin membrane, we use a particle random walk model in one-dimensional membrane system in which space and time variables are discrete. Then we move from discrete to continuous variables. We show that the boundary conditions depend on both selective properties of the membrane and a type of diffusion in the system.

The Neumann boundary value problem (BVP) for the second order “stationary heat transfer” elliptic partial differential equation with variable coefficient is considered in two-dimensional bounded domain. Using an appropriate parametrix (Levi function) and applying the two-operator approach, this problem is reduced to some systems of boundary-domain integral equations (BDIEs). The two-operator BDIEs in 2D have special consideration due to their different equivalence properties as compared to higher dimensional case due to the logarithmic term in the parametrix for the associated partial differential equation. Consequently, we need to set conditions on the domain or function spaces to insure the invertibility of the corresponding layer potentials, and hence the unique solvability of BDIEs. Equivalence of the two operator BDIE systems to the original Neumann BVP, BDIEs solvability, uniqueness/non uniqueness of the solution, as well as Fredholm property and invertibility of the BDIE operator are analysed. Moreover, the two operator boundary domain integral operators for the Neumann BVP are not invertible, and appropriate finite-dimensional perturbations are constructed leading to invertibility of the perturbed operators.\\ \noindent\textbf{Key words:} Partial differential equation, Two-operator Boundary-Domain Integral Equations, finite-dimensional perturbations , equivalence, invertibility.

The formulation and analysis of two operator Boundary-Domain Integral Equation systems for variable coefficient mixed BVP with in two dimensional domain is discussed. To analyse the two-operator approach, we applied one of its linear versions to the mixed (Dirichlet-Neumann) BVP for a linear second-order scalar elliptic variable-coefficient PDE and reduced it to four different BDIE systems. %The two-operator BDIE systems are nonstandard systems of equations containing integral operators defined on the domain under consideration and potential type and pseudo-differential operators defined on open sub-manifolds of the boundary. Using the results as in CMN09 andAM11, a rigorous analysis of the two-operator BDIE systems is given and it is shown that they are equivalent to the mixed BVP and thus are uniquely solvable, while the corresponding boundary domain integral operators are invertible in the appropriate Sobolev-Slobodetski (Bessel potential) spaces.

In this paper, the Boundary-Domain Integral Equations (BDIEs) for the mixed boundary value problem(BVP) for a compressible Stokes system of partial differential equation (PDE) with variable coefficient in 2D is considered . An appropriate parametrix is used to reduce this BVP to the BDIEs. Although the theory of BDIEs in 3D is well developed, the BDIEs in 2D need a special consideration due to their different equivalence properties. As a result, we need to set conditions on the domain or on the spaces to ensure the invertibility of corresponding parametrix-based integral layer potentials and hence the unique solvability of BDIEs. The properties of corresponding potential operators are investigated. Equivalence of the BDIE systems to the mixed BVP and invertibility of the matrix operators associated with the BDIE systems in appropriate Sobolev spaces are proved.

In this paper, the Dirichlet and Neumann boundary value problems for the steady state Stokes system of partial differential equations for a compressible viscous fluid with variable viscosity coefficient is considered in two-dimensional bounded domain. Using an appropriate parametrix, this problem is reduced to a system of direct segregated boundary-domain integral equations (BDIEs). The BDIEs in the two dimensional case have special properties in comparison with the three dimension because of the logarithmic term in the parametrix for the associated partial differential equations. Consequently, we need to set conditions on the function spaces or on the domain to ensure the invertibility of corresponding parametrix-based hydrodaynamic single layer and hypersingular potentials and hence the unique solvability of BDIEs. Equivalence of the BDIE systems to the Dirichlet and Neumann BVPs and the invertibility of the corresponding boundary-domain integral operators in appropriate Sobolev spaces are shown.

The broad environmental, societal and animal welfare issues associated with large-scale animal protein production are well-documented, and cultivated meat represents a potentially more sustainable alternative protein form to conventional production methods. Some believe cultivated meat is years away from commercial success; however, computational modeling has real potential to reduce the timeline for commercial roll-out. In June, 2019, a diverse group of stakeholders attended the inaugural Cultivated Meat Modeling Consortium meeting in Seattle, Washington to develop a multiscale modeling framework for cultivated meat manufacturing. This whitepaper was created from the extensive brainstorming that occurred during the meeting and afterwards. The early stage framework presented here is meant only as a beginning, and our hope is that this paper will drive future discussions and generate more collaborations that maximize the utility of computational modeling in the areas outlined here and beyond.

The paper is devoted to the Stackelberg control of a linear parabolic equation with missing initial conditions. The strategy involves two controls called follower and leader. The objective of the follower is to bring the state to a desired state while the leader has to bring the system to rest at the final time. The results are obtained by means of Fenchel-Legendre transform and appropriate Carleman inequalities.

In this study, we firstly introduce a different type of directional Fermi-Walker transportations along with vortex lines of a non-vanishing vector field in three-dimensional space. Thus we conclude that geometric quantities, which are used to characterize vortex lines, are also associated with the geometric phase and angular velocity vector (Darboux vector) of the system. Then we present directional magnetic vortex lines by computing the Lorentz force. Hence, we reach a remarkable relation between directional magnetic vortex lines and angular velocity vector of vortex lines with a non-rotating frame. We later determine the directional electric vortex lines by considering the electromagnetic force equation. We finally investigate the conditions of being uniform for magnetic fields of directional magnetic vortex lines and we improve a remarkable approach to find the electromagnetic curvature, which contains many geometrical features belonging to directional electric vortex line.

In this paper, we use Schauder and Banach fixed point theorem to study the existence, uniqueness and stability of periodic solutions of a class of iterative differential equation $$\alpha x’‘(t)+\beta x’(t)+\gamma x(t)=\lambda_1(t)x(t)+\lambda_2(t)x(x(t))+\cdots+\lambda_n(t)x^{[n]}(t)+f(t).$$

Up to present, research on shout options remains only on the assumption that the underlying asset follows either Brownian motion or geometric Brownian motion. But it can not be evaluated accurately by PDE on geometric Brownian motion. To solve this problem this paper derives a new partial integro-differential inequality (PIDI) for shout options pricing on the assumption that the price of the underlying asset follows the jump-diffusion model and constructs the mathematical model by combining specific features and terminal conditions. On the basis of this model we obtain some results about shout options pricing. For this mathematical model this paper proposes a new competitive algorithm to choose two aspects. One is employing high-order difference for integral and partial derivative terms, the other is using Howard algorithm (also called policy iteration) for the complementarity problem. Numerical examples show that this algorithm yields an accurate technique and is more efficient than the traditional approaches in the case of geometric Brownian motion and jump-diffusion model, respectively.

Deepening and expanding the understanding of cyanide-degrading enzymes are the foundation of developing new technology for cyanide bioremediation. In this study, a putative cyanide-degrading enzyme gene from Alcaligenes sp. DN25(CGMCC 5734) was cloned and expressed in Escherichia coli. The purified recombinant enzyme named as cdE, consisting of a 38-kDa polypeptide, showed 99% amino acid sequence identity with cyanidase derived from Pseudomonas stutzeri AK61. However, the cdE was supposed to have both cyanide dihydratase (CynD) and cyanide hydratase (CHT) activities based on the findings that formate, ammonium and formamide were simultaneously generated during cyanide enzymatic degradation. The enzymatic properties of cdE were characterized with an optimal activity at a temperature of 30°C, pH of 7.0, and could even maintain approximately 50% activity at pH 9.0. More importantly, the selectivity of enzymatic reaction pathway was suggested related to the conformation stability of the cdE that affected by the modifications of amino acids near the active site as well as the degradation conditions, leading to produce different ratios of formate and formamide. As far as we know, this is the first report of a cyanide-degrading enzyme possessing bifunctional catalysis activity, which might become a supplement of cyanide-degrading enzyme databases.

Benthic macrofauna is regularly used in monitoring programmes, however the vast majority of benthic eukaryotic biodiversity lies mostly in microscopic organisms, such as meiofauna (invertebrates < 1 mm) and protists, that rapidly responds to environmental change. These communities have traditionally been hard to sample and handle in the laboratory, but DNA sequencing has made such work less time consuming. Compared to DNA sequencing that captures both alive and dead organisms, environmental RNA (eRNA) can be used to better target alive communities. Here, we assessed the biodiversity of three known bioindicator microeukaryote groups (nematodes, foraminifera, and ciliates) in sediment samples collected at seven coastal sites along an organic carbon (OC) gradient. We aimed to investigate if eRNA shotgun sequencing can be used to simultaneously detect differences in 1) biodiversity of multiple microeukaryotic communities, and 2) functional feeding traits of nematodes. Results showed that biodiversity was lower for nematodes and foraminifera in high OC (6.2–6.9 %), when compared to low OC sediments (1.2–2.8 %). The beta diversity for all three groups were different along the OC gradient, as well as the classified feeding type of nematode genera (with more non-selective deposit feeders in high OC sediment). High relative abundant genera included nematode Sabatieria and foraminifera Elphidium in high OC, and Cryptocaryon-like ciliates in low OC sediments. Considering that future sequencing technologies are likely to decrease in cost, the use of eRNA shotgun sequencing to assess biodiversity of living benthic microeukaryotes could be a powerful tool in recurring monitoring programmes.

Parental effects influence offspring phenotypes through pre- and post-natal routes but little is known about their molecular basis, and therefore their adaptive significance. Epigenetic modifications, which control gene expression without changes in the DNA sequence and are influenced by the environment, may contribute to parental effects. Taking advantage of the self-fertilising and inbred nature of the mangrove killifish Kryptolebias marmoratus, we investigated the effects of the rearing environment on parents and offspring by comparing neophobia, metabolic rate and brain epigenetic (DNA methylation) patterns of genetically identical fish reared in enriched or barren environments. Parental fish reared in enriched environments had lower cortisol levels, lower metabolic rates and were more active and neophobic than those reared in barren environments. They also differed in 1,854 methylated cytosines (DMCs). Offspring activity and neophobia were determined by the parental environment and we also found evidence of, limited but significant, parental influence on the DNA methylation patterns of the offspring. Among the DMCs of the parents, 98 followed the same methylation patterns in the offspring, three of which were significantly influenced by parental environments irrespective of their own rearing environment. Our results suggest that the environment experienced by the parents influences the behaviour and, to some extent, brain DNA methylation patterns of the offspring in an environment-specific manner.

Interfacial tension is an essential physical property in two phase flow and it changes due to the mass transfer. The measurement of dynamic interfacial tension (DIFT) in such condition is a difficult problem. In previous study (Zhou at al., Chem Eng Sci. 2019; 197:172-183), we presented the quantitative relation between the droplet breakup frequency function (DBFF) and interfacial tension. It is found that the DBFF is highly depends on interfacial tension. Therefore the DBFF is a suitable parameter to quantitatively characterize the interfacial tension. Based on this concept, the DIFT in the column is determined by regression method after the DBFF under mass transfer condition is measured. It is found that the DIFT is smaller than the static interfacial tension. This result indicates that interphase mass transfer leads to decreasing of the interfacial tension. The decreasing extent of the DIFT has a positive correlation with the mass transfer flux.

Temperature is one of the most important abiotic factors defining the yield potential of temperate cereal crops such as barley. The regulators of heat shock response (HSR); Heat shock factors (HSFs) modulate the transcription level of heat responsive genes in order to protect the plants against heat stress. In the present study, a heat shock factor from wheat (TaHSFA6b) is overexpressed in barley for providing thermotolerance. Transgenic barley lines overexpressing TaHSFA6b showed significant improvement in thermotolerance. The constitutive overexpression of TaHSFA6b gene upregulated the expression of major heat shock protein genes as well as other abiotic stress responsive genes. RNA-seq and qRT-PCR analysis showed upregulation of HSPs, chaperonins, DNAJ, LEA proteins and genes related to anti-oxidative enzymes in transgenic lines. Excessive generation and accumulation of ROS occurred in wild type plants during heat stress; however, the transgenic lines reflected improved ROS homeostasis mechanisms in the form of significantly low ROS accumulation under high temperature. There were no negative phenotypic changes in overexpression lines. The present study suggests that TaHSFA6b is one of the major regulators of HSR as it showed the capacity to alter the expression patterns of main defense related genes and enhance the thermotolerance of this cereal crops.