In this paper, we propose an algorithm for solving a two-point boundary-value problem for a linear differential equation with constant delay subject to a nonlinear boundary condition. We derive sufficient conditions for the convergence of the algorithm and for the existence of an isolated solution to the problem under study. A numerical example is provided.

Groundwater-dependent terrestrial ecosystems (GWDTE) have been increasingly under threat due to groundwater depletion globally. Within the past 200 years, there has been severe artificial drainage of low-lying areas in Denmark, leading to a gradual loss of GWDTE nature habitat areas. This study explores the spatial-temporal loss of Danish GWDTE using historically vectorized topographical maps. We carry out geographic information systems (GIS) overlap analysis between different historical topographic maps with signatures of GWDTE starting from the 19 th century up to a current river valley bottom map as a reference period. This is because farmworkers and monks have practiced drainage by ditching since the early middle ages (1100-1200). We then examine the changes in two protected GWDTE habitat types in different periods and different hydrologic spatial locations. Results reveal a decrease in the area of GWDTE over the last 200 years. We attribute this to different human interventions that through e.g., drainage, have impacted the low-lying landscape throughout history. We further conclude that downstream parts of the river network have been exposed to less GWDTE habitat loss than upstream ones. This indicates that upstream river valleys are more vulnerable to GWDTE decline. Therefore, as a management measure, caution should be exercised when designing these areas for agriculture activities using artificial drainage and groundwater abstraction since this may lead to further decline. In contrast, there is a higher potential for establishing constructed wetlands or rewetting peatlands to restore balance.

Segmentina nitida Müller 1774 is a freshwater snail which was formerly widespread throughout England and south Wales. Since the 1840s it has seen a rapid decline in its range which has been attributed to deteriorating water quality due to nutrient enrichment, lowering of water tables and over-management of the ditches in which it resides. Segmentina nitida has therefore been identified as a UK Biodiversity Action Plan (UKBAP) priority species which recommends further research for its conservation. Here we have developed a Taqman based qPCR eDNA assay for the detection of S. nitida at the Stodmarsh National Nature Reserve and compared the results with a manual survey of the ditches at this location. Our eDNA analysis exhibited an observed percentage agreement of 84% with a kappa coefficient of agreement between manual and eDNA surveys of 0.56. Three ditches determined to be negative for Segmentina nitida by eDNA analysis were manual survey positive, and a further two ditches that were negative by manual survey were positive by eDNA analysis revealing the potential for improved overall detection rates using a combination of manual and eDNA methodologies. eDNA analysis could therefore augment manual survey techniques for Segmentina nitida as a relatively quick and inexpensive tool for collecting presence and distribution data that could be used to inform manual surveys and management of ditches.

Background: It is not known whether the optimal Atrioventricular delay (AV opt) varies between left ventricular (LV) pacing site during endocardial biventricular pacing (BiVP) and may therefore needs consideration. Methods: We assessed the haemodynamic AV opt in patients with chronic heart failure undergoing endocardial LV lead implantation. AV opt was assessed during atrio-biventricular pacing (BVP) with a “roving LV lead”. Up to four locations were studied: mid lateral wall, mid septum (or a close alternative), site of greatest haemodynamic improvement and LV lead implant site. The AV opt was compared to a fixed AV delay of 180ms. Results: Seventeen patients were included (12 male, aged 66.5 +/- 12.8 years, ejection fraction 26 +/- 7%, 16 left bundle branch block or high percentage of right ventricular pacing (RVP), QRS duration 167 +/-27 ms). In most locations (62/63), AV opt increased systolic blood pressure during BiVP compared with RVP (relative improvement 6 mmHg, IQR 4-9mmHg). Compared to a fixed AV delay the haemodynamic improvement at AV opt was higher (1mmHg, IQR 0.2-2.6mmHg, p<0.001). Within most patients (16/17), we observed a difference in AV opt between pacing sites (median paced AV opt 209 ms, IQR 117-250). Within this range, the haemodynamic impact of these differences was small (median loss 0.6 mmHg, IQR 0.1-2.6mmHg). Conclusion: Within a patient, different endocardial LV lead locations have slightly different haemodynamic AV opt which are superior to a fixed AV delay. The haemodynamic consequence of applying an optimum from a different lead location is small.

This Supporting Information includes information regarding the magnetic field of the actuator magnet, MR-LF-S (which has the same geometry as MR-LF and a soft compartment), and a table comparing MR-LF to other small-scale, flexible magnetic crawler robots.  Corresponding author email:   yong.kong@utah.edu

Three-dimensional (3D) electromagnetic (EM) parametric modeling and implementation of miniaturized lumped-element power divider (PD) based on symmetrical configuration is investigated. The system design and schematic diagrams of PDs are firstly demonstrated, subsequently, the 3D EM field and field-circuit co-simulation models of PD utilizing computer simulation technology (CST) and advanced design system (ADS) tools are detailedly presented. Finally, one prototype is fabricated and measured. Simultaneously, the gain of the PD is -3.96 dB @ 100 MHz and the experimental curve is in excellent agreement with the simulation. As a conclusion, the novel design methodology applied in PD has important practical engineering value, which can be also applied in millimeter-wave (mmW) circuit.

We sought to assess effect of plant environmental adaptation strategies and evolutionary history and quantify the contribution of ecological processes to community assembly by measuring functional traits and phylogenetic composition in local forest community. We selected 18 dominant tree species in a Lithocarpus glaber–Cyclobalanopsis glauca evergreen broad-leaved forest and measured nine leaf functional traits and phylogenetic data of each species. We analyzed the variation in traits and trade-off relationships, tested phylogenetic effects on leaf functional traits, explored the influence of phylogeny and environment on leaf functional traits, and distinguished the relative effects of spatial and environmental variables on functional traits and phylogenetic compositions. The results showed the following: (i) Leaf traits had moderate intraspecific variation, and significant interspecific variation existed especially among life forms. (ii) Significant phylogenetic signals were detected only in leaf thickness and leaf area. The correlations among traits both supported “the leaf economics spectrum” at the species and community levels, and the relationships significantly increased or only a little change after removing the influence of phylogeny, which showed a lack of consistency between the leaf functional trait patterns and phylogenetic patterns. We infer the coexistent species tended to adopt “realism” to adapt to their habitats. (iii) Soil total potassium and phosphorus content, altitude, aspect, and convexity were the most critical environmental factors affecting functional traits and phylogenetic composition. Total environmental and spatial variables explained 63.38% of the variation in functional trait composition and 47.96% of the variation in phylogenetic structures. Meanwhile, the contribution of pure spatial factors was significantly higher than that of the pure environment. Neutral- theory-based stochastic processes played dominant roles in driving community functional trait assembly, but niche-theory-based determinative processes such as environmental filtering had a stronger effect on shaping community phylogenetic structure at a fine scale.

This supporting information includes supplemental figures, movies, additional results, and the key steps in the neural network training algorithm.   Corresponding author Email:   yyang60@jhu.edu (Y.Y.)     libome@tsinghua.edu (B.L.)

In this study, the CeO2-WO3/TiO2-n catalyst was synthesized by co-precipitation method with citric acid and the selective catalytic reduction (SCR) performance of citric acid modified CeO2-WO3/TiO2 catalyst was studied. The results demonstrated that compared with CeO2-WO3/TiO2 catalyst, CeO2-WO3/TiO2-6% catalyst has been widened about 30°C in the temperature range of 80% and 90%, respectively, and the highest denitration efficiency was 98.83% at 350°C. Additionally, citric acid formed complex with WO3 and CeO2 and three carboxylic acid groups can improve the stability of WO3 to inhibit the growth of TiO2 and CeO2 crystallites, thus promoting the dispersion of CeO2 and the formation of Ce-O-W solid solution. Furthermore, the strong interaction between CeO2 and WO3 in CeO2-WO3/TiO2-6% catalyst will release more Oα and Ce3+. Citric acid promoted the interaction of unsaturated W atoms and hydroxyl groups adsorbed on unsaturated W atoms, thus providing more Lewis and Brönsted acid sites on the catalyst surface

1. IntroductionPine nuts are seeds that are widely used in world cuisine, obtained from pine cones (Pinaceae family, Pinus genus), with 29 currently known edible species [1, 2]. Pine nuts, nutrient-rich and popular food, contain about 32% protein and 45% fat [3, 4]. The remainder consists of moisture, soluble sugar, ash and minerals such as potassium, phosphorus and magnesium [3]. Although it is commonly referred to as a ”nut”, it actually belongs to the class of ”seeds” because it contains an edible part (embryo) surrounded by a hard shell. Pine nuts have been harvested for human consumption since prehistoric times [1]. Pine nuts are often used raw, as a roasted snack, or as an ingredient in various products that often require a roasting process, such as cakes, breads or desserts [5, 6]. If the shelled pine nuts are kept dry, they can be stored for a long time without any deterioration. Unshelled pine nuts are prone to rapid deterioration and rancidity [1]. Pine nut shells, which have a large annual production, are very suitable raw materials for the production of porous carbon due to their lignin and cellulose contents up to 40%, low ash content, high hardness and fixed carbon content [7, 8]. Pine nut shells are considered as food by-products in the agriculture and food industry. However, pine nut shells have excellent antioxidant properties and functional properties [9]. It is known that the oil yield for 100 g of pine nuts is between 45-65 g and this amount varies depending on the extraction method (cold pressing or solvent). The fatty acids found in pine nuts are polyunsaturated fatty acids (50%), monounsaturated fatty acids (40%) and saturated fatty acids (10%) [6]. Pine nut oil is mainly composed of unsaturated fatty acids such as palmitic acid, stearic acid, oleic acid, linoleic acid, eicosenoic acid and pinolenic acid. Pinolenic acid (PLA) is known as the active compound or reference material of pine nut oil and is effective in wound healing, immune and inflammatory diseases, and cancer [10]. Besides, pine nut oil is also known to reduce body fat, to alleviate hyperlipemia and hypertension [4, 10]. Pine nut oil also contains fat-soluble antioxidants, including phytosterols and squalene, as well as tocopherols [6]. Linoleic acid (LA) is the most common fatty acid in the range of 40-60% of total fatty acids (FAs) and the predominant polyunsaturated fatty acid (PUFA) in pine nut oil (PNO). The high linoleic acid content in PNO is similar to many other seed oils. Oleic acid (cis-9 18:1) is the second most prevalent fatty acid and a significant monounsaturated fatty acid, which constitutes 12-30% of total FAs. PLA is the most common non-interrupted fatty acid (NMIFA) and typically constitutes 14-19% of total FAs in P. koraiensis and P. sibirica . It is reported that taxoleic and sciadonic acid constitute approximately 2% and 1-1.2% of the total FAs in P. koraiensisand P. sibirica , respectively. Delta-7 eicosatrienoic acid (ETA) (all cis-7,-11,-14 20:3) is only present in small amounts (1–3%) in PNOs. Matthaus et al. determined that PLA, taxoleic and sciadonic acids were found in some pine nut oils. Baker et al. found that PLA was much lower, whereas linoleic acid and oleic acid were higher in oils obtained from P. eldarica, P. excelsa, P. pinea and P. torreyanacultivars [6].The top three consumers of pine nuts and PNO are Korea, the United States, and Russia. The oil obtained from P. sibirica hazelnuts consists of 99.4% non-polar lipids and 0.6% polar lipids by weight. Triacylglycerols (TAG) are important components of nonpolar lipids and Acheampong et al. detected 58 different TAG species in the oil ofP. koraiensis . Due to their high TAG content, pine nuts and pine nut oil naturally contain high levels of FA (esterified to TAGs). The functional benefits of these fatty acids, as well as the underlying mechanisms of action, are yet unknown. PLA’s biological impacts might be significant since it could provide a long-term terrestrial alternative to long-chain omega-3 PUFAs, which have been demonstrated to have a variety of health advantages, including inflammation reduction [11, 12].In this study, some physicochemical properties (total crude oil and refractive index value) as well as fatty acids, triglycerides (TAG), tocols and sterol contents of oils obtained by cold pressing from pine nuts grown in Turkey were investigated.

A male passenger arriving at Nanning Wuxu Airport in Guangxi on an international flight from Jakarta, Indonesia, was found to be positive for SARS-CoV-2 nucleic acid on a routine test at the airport on June 8 2021. The passenger was sent to Fourth People’s Hospital of Nanning immediately for further isolation and observation. On the day of admission, the test for SARS-CoV-2 nucleic acid of nasopharyngeal swabs, pharyngeal swabs and sputum specimens were positive (CT values of N gene and ORF1ab gene were between 20 and 30). After 8 weeks of hospitalization, the patient’s test for SARS-CoV-2 nucleic acid of all specimens turned to negative. We isolated a SARS-CoV-2 variant strain from the nasal swab of the patient, and then we found that the genome sequence of the variant strain had 13 base deletions and 38 nucleotide mutations compared with that of the Novel Coronavirus Wuhan strain after sequencing, comparison and analysis. The deletions and mutations of the variant strain resulted in four amino acid deletions and 30 amino acid mutations. Furthermore, we found that the variant strain was similar to those from Indonesia, South Korea and The United Kingdom after conducting BLAST analysis on GISAID platform, among them, hCOV-19 /Indonesia/ Ji-ITD-43591N /2021 was the most similar, with 99.98% similarity and only 8 base differences. The maximum likelihood phylogenetic tree was constructed taking the Wuhan strain as the root and including most the reference sequence contained most of the epidemic strains. The result showed that the strains isolated in our laboratory belonged to Delta strain.

In this study, two neighboring catchments on the Chinese Loess Plateau were selected, in which one catchment was restored with natural vegetation and the other was afforested over 60 years. The spatial and temporal distributions of the soil erosion modulus between 2010 and 2020 were formulated with a spatial resolution of 2 m in the paired catchments based on the revised universal soil loss equation and geographic information system. The results showed that the average soil erosion modulus in 2010-2020 was 12.58 and 8.56 t ha -1 a -1 for the grassland and forestland catchments, respectively. Areas with high soil erosion rates (> 80 t ha -1 a -1) were mainly distributed in the topography of the middle transition zone with a steep slope gradient (> 45°). Moreover, the average annual rainfall erosivity for the grassland and forestland catchments in 2010-2020 was 1628 and 1851 MJ mm/ (ha ·h ·a), respectively. In this study, the forestland catchment showed high rainfall erosivity and a low soil erosion rate. We conclude that a dense cover of trees and understory in the gully of the forestland catchment played a crucial role in controlling soil loss. This study fills a gap in mapping the spatial distribution of soil erosion with high-resolution data and provides a reference for soil conservation and water management at the catchment scale.

The performance of the Cuban biotechnology from 2008 to 2021 has shown a growing pipeline of valuable biomedical solutions. As transformation of this sector into an industrial group has changed its R&D productivity and biomanufacturing capacity, we summarize here results of R&D projects with impact on public health, constraints found in Cuba, lessons, and opportunities to develop this science-based industry in developing countries.

sputum acid-fast bacilli were positive and anti-TB treatment was started. Her cerebrospinal fluid results were normal except for a positive nested polymerase chain reaction (PCR) for tuberculous. She responded to protocol for treatment of status epilepticus and anti-TBM treatment and her level of consciousness improved and she became fully aware

This case report describes a peculiar and innovative fixing procedure in the unusual case of magnet dislodgement and rupture of the cochlear implant (CI) silicone sheath holding the magnet. The poly-D,L-lactic acid (PDLLA) mesh provided excellent results in terms of stability, protection, preserved signal transmission and patient comfort. Its

Beside their lipid lowering functions, statins impose some additional effects known as the pleotropic effects. In endothelial progenitor cells (EPO) and cancer cells statins have been shown to impose the opposite effects on the cell cycle, senescence and apoptosis. The most significant reason may arise from bias in selecting the applied doses in cancer cells compared to those used in EPO cells; in EPOs it was evident that lower (nanomolar) concentrations of statins impose anti-senescence, anti-apoptotic, and angiogenic effects; however, higher doses (micromolar) imposed the adverse effects. In cancer cells, most studies used high (micromolar) doses of statins showing statins-induced apoptosis. Some studies indicated that even at low concentrations (nanomolar) statins induced senescence or imposed cytostatic but not cytotoxic effects. Regardless of the concentrations, statins in cancer cells induce apoptosis or cell cycle arrest, anti-proliferation effects, and cause senescence. However, their effects on EPOs depend on the concentrations.

With the development of cellular, chemical, and molecular biology, such as, single-cell, single-molecule, single-nucleus, single-chromosome and other related biotechnologies for analysis of chromatin regions, and under the help of single-nucleus and single-cell transcriptomics of human diseases in cardiovascular system, there are many novel breakthroughs in the field of life science and medicine. It can be said that a new “single” era of biomedicine comes. As transforming medical research tools at single-cell levels, single-cell technologies including single-cell RNA sequencing (scRNA-seq) provide high-resolutions insight into complex tissues covered cardiovascular and brain systems, they can help to understand molecular mechanisms of both COVID-19 and cardiovascular disease (CVD), such as atherosclerosis (AS), acute myocardial infarction (AMI), arrhythmogenic cardiomyopathy (ACM), inherited thoracic aortic aneurysm (iTAA) or ascending thoracic aortic aneurysm (ATAA), calcific aortic valve disease, heart failure, and others as well as develop novel therapeutic targets and approaches relevant for CVD and COVID-19.

Title pageTitle: Reply to Jasinski M et al.: ´Indeed, there is still room for improvement in long‐term durability of BAV repair´Authors: Tomas Holubec, MD, PhD, Mojyan Safari, MD, Arnaud Van Linden, MD, Anton Moritz, MDInstitutions and Affiliations: Department of Cardiovascular Surgery, University Hospital Frankfurt and Goethe University Frankfurt, Frankfurt, GermanyCorresponding author: Assoc. Prof. Tomas Holubec, MD, PhD, Theodor-Stern-Kai 7, 60596 Frankfurt/Main, Germany, Tel.: +49 69 6301 80094, Email: tomasholubec@email.cz

Environmental DNA measurement has been widely applied in organism biomonitoring. Different DNA extraction methods may cause changes in yield and stability, resulting in an inaccurate estimation of eDNA, especially when quantitative measurements are performed. This study focused on the DNA extraction method and compared its yield and stability for stream fish and spiked DNA samples. Samples were collected periodically over a year from river and lake water systems and eDNA was spiked into them. The samples were extracted and compared using three methods: using Buffer-AL for initial lysis with the DNeasy Blood and Tissue Kit (Qiagen); using Buffer-ATL for initial lysis and the microfluidic-channel method (BC method). The method using Buffer-ATL in the DNeasy Blood and Tissue Kit showed better stability and a higher yield than the Buffer-AL method. In addition, the BC method, despite being comparatively simple, performed the extraction stably and with relatively high yields. We showed that differences in DNA extraction methods based on the long-term evaluation of eDNA measurements with various methods may cause alterations in DNA yield and stability.

- The Gerbode type of ventricular septal defect is rare and can be congenital or acquired. - The defect can be closed retrograde or through the transvenous approach. - Short term follow-up suggests that transcatheter closure of the Gerbode type defect is feasible, safe, and effective and should be considered an alternative to surgical repair

Significant dilemma exists regarding management of the aortic root pathology in acute aortic dissections. Several strategies for both repair and replacement exist and there is a lack of clarity on the superiority of one over the other. Important factors that influence management strategies include involvement of the sinuses, competence of the aortic valve, presence of Marfan's syndrome and connective tissue disorders, as well as availability of surgical expertise. The wide variability in these factors makes it unlikely for any one technique to be suitable for management of all aortic roots and the root pathology has to be tailored to an individual patient.

MTA® is considered as the biomaterial of choice because of its excellent characteristics. Recently, Biodentine™ has been introduced into periapical surgery and has proven its efficacity in sealing root-end-cavities. Despite of the desirable properties of Biodentine™, there are limited published cases that described the use of Biodentine™ in periapical surgery.

Limb weakness is an uncommon symptom in children, with multiple factors contributing to related diseases, particularly genetic disorders. A nine-year-old boy presented with slowly progressive muscle weakness of the limb-girdle muscles. We evaluated the clinical symptoms, laboratory tests, imaging examinations, and pathological examinations of this proband. We combined whole-exome and Sanger sequencing to identify the novel compound heterozygous pathogenic mutations NM 001849.3: c.1970-10_1978 del CGGCTTGCAGGGACGCGTG and c.2462-3C>A in COL6A2 in this proband inherited from the mother and father, respectively. Mutational confirmation at the mRNA level demonstrated that the proband carried a homozygous abnormal sequence with 23bp deletions (c.2462-2484 del GGACGCGTGTGGGCGTGGTGCAG) at the beginning of exon 26. In contrast, both parents and sibling have normal sequences with no clinical symptoms. The results of this study further expand the mutational spectrum and will be helpful for further molecular diagnosis.

Drought and heat stress are major abiotic stress factors that limit photosynthesis and other related metabolic processes that hamper plant growth and productivity. Identifying plants that can tolerate abiotic stress conditions is essential for sustainable agriculture. Amaranthus plants can tolerate adverse weather conditions, especially drought and heat, and their leaves and grain are highly nutritious. Because of these traits, amaranth has been identified as a possible crop to be grown in marginal crop production systems. Therefore, this study investigated the photochemical and biochemical responses of Amaranthus caudatus, A. hypochondriacus, A. cruentus and A. spinosus to drought stress,heat shock treatments and a combination of both. After six-leaf stage in a greenhouse, plants were subjected to drought stress, heat shock treatments and a combination of both. Chlorophyll a fluorescence was used to evaluate the photochemical responses of photosystem II to heat shock while subjected to drought stress. It was found that heat shock and a combination of drought and heat schock damages photosystem II, but the level of damage varies considerably between the species. We concluded that A. cruentus and A. spinosus are more heat and drought tolerant than A. caudatus and A. hypochondriacus.