Lycorine plays an anti-inflammatory role by inhibiting LXRα activity and destroying the stability of lipid rafts in acute lung injury of mice Fuhan Wang a, Kan Lia, Xiaohan Li a, Yao Xue a, Ziyi Lia, Jilong Luoa, Bing Zhao a, *, Xue-jiao Gao a, *a College of Veterinary Medicine, Northeast Agricultural University, Harbin 150030, People’s Republic of China.*Corresponding author.Address: College of Veterinary Medicine, Northeast Agricultural University, Harbin 150030, People’s Republic of China.E-mail address: xuejiaogao@126.comDeclarations of interest: none AbstractLycorine is an alkaloid that was in the bulb of the genus Lycoris. It has properties of anti-inflammatory. This study aimed to investigate the molecular mechanism by which lycorine can reduce acute lung injury (ALI). ALI model was established by intranasal injection of lipopolysaccharide (LPS). In vitro, primary mouse lung cells were treated with LPS and pretreated with lycorine for 1 hour. The results showed that lycorine reduced histopathological changes in lung, myeloperoxidase (MPO) activity, and the production of inflammatory cytokines such as TNF-α, IL-1β, and IL-6 in mice. Lycorine dose-dependently inhibited the production of TNF-α, IL-1β, and IL-6. It also inhibited the transmission of TLR4/NF-κB passway in LPS-stimulated primary mouse lung cells. Lycorine increased cholesterol efflux through the activated LXRα-ABCA1/ABCG pathway. Lycorine has a good binding ability with LXRα. After adding the LXRα inhibitor, the anti-inflammatory effect of lycorine was eliminated. Conclusion: Lycorine can reduce ALI that was induced by lipopolysaccharide. The anti-inflammatory mechanism of lycorine is related to the up-regulation of the LXRα-ABCA1/ABCG pathway, which inhibits TLR4-mediated inflammation by increasing cholesterol efflux and reducing TLR4 transport to lipid rafts. Keywords: Lycorine; ALI; Lipid raft; TLR4; LXRα 1. IntroductionAcute lung injury (ALI) is a high morbidity and mortality disease. In recent years. Many people were died of ALI due to influenza and COVID-19(Zhang et al. , 2021a). ALI is the damage of alveolar epithelial cells and capillary endothelial cells caused by multiple direct or indirect injury factors. Alveolar epithelial cells are widely present in lung tissue. The damage of alveolar epithelial cells will cause diffuse pulmonary interstitial fibrosis and swelling(Shi et al. , 2014). Lipopolysaccharide (LPS) is one of the important causes of ALI(Hu et al. , 2021). LPS expressed its effects through the TLR family in cell membranes. The TLR family was related to inflammatory cytokines(Gross et al. , 2020, Vitiello et al. , 2021). TLR4 played an important role in natural immunity. LPS can promote the formation of lipid rafts. After LPS stimulation, TLR4 was recruited into the lipid raft(Kaelberer et al. , 2020). It interacted with some molecules on the lipid raft. It could activate the NF-κB signaling pathways and promoted the production of cytokines(Liao et al. , 2021, Xu et al. , 2023b). Lots of cytokines caused the body's inflammatory response, leading to multiple organ failures in severe cases(Wang et al. , 2021).The production of inflammatory factors required regulating signaling pathways(Alikiaii et al. , 2021, Novoselova et al. , 2015). Most signals were passed through something on the cell membrane, and lipid rafts were one of them(D'Aprile et al. , 2021). Lipid rafts were the platform for protein docking, closely related to membrane signal transduction and protein sorting(Holani et al. , 2020, Suzuki, 2012). The stability of lipid rafts played an important role in the TLR4/NF-κB pathway(Adebiyi et al. , 2014, Liu et al. , 2018, Zhang et al. , 2023). It was showed that the destruction of lipid rafts in lung epithelial cells could inhibit inflammatory response by LPS-induced(Colardo et al. , 2021, Singh et al. , 2021). The destruction of lipid rafts was associated with cholesterol metabolism on the cell membrane. Previous studies had found that cholesterol metabolism was related to nuclear receptors, liver X receptor (LXR), and had a regulatory effect on lipid metabolism. LXRs (Liver X Receptor α and β) are members of the nuclear hormone receptor superfamily of ligand-activated transcription factors (Hammer et al. , 2021). Activation of LXRs could induce gene expression related to cholesterol excretion, such as ABCG(Song et al. , 2021, Wan et al. , 2021). LXRs regulated the cholesterol metabolism of cells, affected the inflammatory response, and inhibited the expression of inflammatory genes(Kongkwamcharoen et al. , 2021). It may be related to the pathogenesis of ALI. Currently, there is no very effective way to treat this disease. Some herbal medicines have been found to have anti-inflammatory effects and may be used to treat ALI. Lycorine is an alkaloid in the bulb of Lycoris Radiata, a plant of the family Lycoris Radiata. It has effective anti-inflammatory, anti-viral and anti-tumor effects (Chen et al. , 2020a, Li et al. , 2022, Li et al. , 2021b). Does lycorine have a similar anti-inflammatory effect on ALI? Could it be used as a medicine in the clinical treatment of ALI? Previous studies had shown that lycorine can induce HSC-3 cell apoptosis and inhibit cell proliferation (Liu et al. , 2019). In addition, it has been found that lycorine can increase the production of reactive oxygen species (ROS) and trigger mitochondrial membrane potential (MMP) disorders(Jing et al. , 2020, Shang et al. , 2021). It was also found that lycorine significantly inhibited the expression of CXCL1 and IL-1α in the senescence-associated secretion phenotype (SASP) of SIPS cells and slowed down senescence(Xu et al. , 2023d, Zhang et al. , 2021b). However, few reports show lycorine can reduce lung injuries caused by inflammation and oxidative stress. Whether lycorine has a protective effect on lung injury needs further study. Lycorine could reduce the inflammatory response of LPS-induced by destroying the lipid rafts was not yet clear. This mechanism remains to be explored.2. Materials and methods2.1. ReagentsLycorine (L812279) was purchased from MACKLIN reagent, China. LPS (S11060) was purchased from Yuanye biotech, Shanghai. UItraRIPA kit for Lipid Raft (KA6023) was purchased from Bioleaf, Shanghai. The primers were purchased from Sangon Biotech, Shanghai. The antibodies were purchased from CST, USA. CCK-8 (BS350B) kit was purchased from Biosharp, China. MPO assay kit (EHJ-45871m) was purchased from HUIJIA BIOTECHNOLOGY, China. The ELISA kit of IL-1β, IL-6, and THF-α was purchased from LunChangShuo Biotech, China. LXR-Luc(11515ES) was purchased from Yeasen Bio, China.GSK2033 (SML1617) was purchased from Sigma Aldrich, USA. 2.2. Animals and groups Fifty C57BL/6 mice (6 weeks of age, 18-25 g) were divided equally between male and female. All mice were randomly divided into 5 groups: control group (CG), LPS group (LPS), and LPS+lycorine (20, 40, 80 mg/kg) group (20, 40, 80). LPS-induced acute lung injury and administration were as follows: In brief, ALI was induced by inhalation of 50 μl 2 mg/mL LPS through the nose in each mouse after injected lycorine (20, 40, 80 mg/kg) or saline intraperitoneally(Wang et al. , 2009). The drug was injected twice in total intraperitoneally at 12-hour intervals. The control group was injected with saline. The lycorine group was injected with different doses of lycorine hydrochloride solution (20, 40, 80 mg/kg). All mice survived within 36 h after LPS intranasal infusion. All mice were raised at room temperature and anaesthetized with sodium pentobarbital 24 hours after the second intraperitoneal injection. They died of cervical dislocation and were quickly sampled and store in the -80 °C refrigerator. All the procedures in the present study were carried out following the Animal Care and Use Committee of Northeast Agricultural University (SRM-16). All Institutional and National Guidelines for the care and use of animals (fisheries) were followed.2.3. Histology analysis The fresh lung tissue of the mice was cut into 2mm-3mm tissue pieces, fixed with 10% neutral phosphate-buffered formalin, dehydrated and transparent, and then immersed in paraffin and cut into 3-5micron paraffin tissue sections. After staining with hematoxylin and eosin, the pathological changes in lung tissues were observed with a light microscope.2.4. Detection of myeloperoxidase contentThe double antibody sandwich method was used to determine the content of myeloperoxidase (MPO) in the sample. Coat the microtiter plate with purified mouse MPO antibody to make a solid phase antibody. Add MPO to the microporous of the coated monoclonal antibody, and then combine with the HRP-labeled MPO antibody to form an antibody-antigen-enzyme-labeled antibody complex. After thorough washing, add substrate TMB for color development. We calculated the content of MPO according to the OD value.2.5. Immunofluorescence analysis of lipid raftsDewaxing paraffin sections to water. The tissue sections were placed in a repair box filled with EDTA antigen repair buffer (PH8.0) and repaired in a microwave oven. Excessive evaporation of buffer solution should be prevented during this process. BSA was dropped onto the tissue sections and incubated for 30min. The BSA was gently removed, and the prepared flotillin-1 antibody was dropped onto the sections. The sections were placed flat in a wet box at 4°C and incubated overnight. Add secondary antibody and incubate at room temperature for 50min. After the slices were shaken dry, DAPI dye was added to the ring and incubated for 10min at room temperature, away from light. The self-quenching agent was added for 5min, and the water was rinsed for 10min. Tablets were sealed with anti-fluorescence quenching tablets. The sections were photographed under a fluorescence microscope.2.6. Extraction of cell membrane proteinAdd appropriate volume of ice-cold A-buffer to tissue samples (final concentration, 5 mg/ml total protein). Sonication is recommended to completely disrupt tissue debris and avoid contamination of the nucleus. Transfer tissue lysate to 1.5 mL tubes. Centrifuge samples at 10000 rpm for 5 min. Transfer supernatant to another tube. Add 0.5 mL of ice-cold A-buffer into the pellet (RIPA-insoluble fraction) and vigorously re-suspend the pellet with pipetting or voltas. Centrifuge samples at 10000 rpm for 5 min. Remove supernatant and add 100 μL of B-buffer into the pellet and vigorously re-suspended the pellet with pipetting or voltas at room temperature (option: sonication can be available on ice). Incubate for 5 min at room temperature. Centrifuge samples at 10000 rpm for 5 min. Collect the supernatant into a new tube.2.7. Cholesterol levels assay in cell membraneMeasure the absorbance values of the calibration standard tube and the sample tube at 510nm respectively, and calculate the cholesterol content. Cholesterol esters are broken down into cholesterol fatty acids under the action of cholesterol esterase. Cholesterol and oxygen generate hydrogen peroxide under the action of cholesterol oxidase. Hydrogen peroxide, 4-AAP, and phenol will produce red quinone under the action of peroxidase, and its color is directly proportional to the content of cholesterol. Measure the absorbance values of the calibration standard tube and the sample tube at 510nm respectively, and calculate the cholesterol content.2.8. cell culture and treatmentThe mice were sacrificed after neck removal and soaked in 75% ethanol for 5 min. Add 1 g/L trypsin (containing DnaseⅠ0.01 g/L) at a rate of 2 mL/mouse, mix with a pipette, incubate at 37℃ for 5 min, remove the digested cell suspension, and add DMEM containing 10% fetal bovine serum equal to the digestive fluid to stop digestion. 1g/L type I collagenase (containing DnaseⅠ0.01 g/L) was added to the remaining lung tissue at the rate of 2 m L/ mouse, and then mixed with a pipepipe and incubated at 37℃ for 15 min. The cell suspension was removed and DMEM containing 10% fetal bovine serum equal to the digestive fluid was added to stop digestion. The cell suspension was combined, thoroughly blown and mixed with a straw, filtered with a 200-mesh screen, centrifuged at 800 r/min for 5 times, removed supernatant, and precipitated with DMEM 10 mL containing 10% fetal bovine serum by volume. Inoculated in 90 cm2 disposable petri dish and 6-well culture plate at a density of 4×105 PCS /cm2, cultured in an incubator with a volume fraction of 5%CO2 at 37℃, and changed the liquid after 24 h of culture. And according to the group for different processing.2.9. LXRα gene assayPrimary mouse lung cells were cultured in a medium supplemented with LXR luciferase reporter plasmid (LXR-Luc) and β-galactosidase control vector for 24 h. Others were cultured in a medium supplemented with LXR inhibitor GSK2033. Primary mouse lung cells were pretreated with lycorine (20,40,80 mg/L). After 1 hour, the culture medium was poured out and LPS (3mg/kg) was added for 24 hours. Luciferase activity was detected. The transcriptional activity of the LXR-Luc assay system was compared with that of the β-galactosidase normal group. Cell culture supernatants were collected and the levels of TNF-α, IL-1β, and IL-6 were determined by ELISA after transfection with primary mouse lung cells. 2.10. Molecular docking analysis of LXRα and lycorineChemBioDraw Ultra 14.0 was used to draw small molecules, and the small molecules were imported into ChemBio3D Ultra 14.0 for energy minimization. The Minimum RMS Gradient was set to 0.001, and the small molecules were saved in MOL2 format. The optimized small molecules were imported into AutoDockTools-1.5.6 for hydrogenation, charge calculation, charge distribution, and rotatable bond setting and then kept in "PDBQT" format. Download the LXRα structure (PDB ID: 3FAL) from the PDB database. Pymol2.3.0 was used to remove the protein crystal water and original ligand. The protein structure was imported into AutoDocktools (V1.5.6) for hydrogenation, charge calculation, charge distribution, and atom type designation and saved in "PDBQT" format. AutoDock Vina1.1.2 was used for docking, and LXRα parameters were set as: center_x = 64.711, center_Y = 37.098, center_z = 23.658; The search space: size_x: 50, size_y: 50, size_z: 50 each lattice spacing is 0.375 (A) and exhaustiveness: 10, the rest of the parameters as the default Settings. PyMOL2.3.0 and LIGPLOT V 2.2.4 were used to analyze the interaction mode of the docking results.2.11. Polymerase chain reactionTotal RNA was extracted from mice lung tissue and Primary mouse lung cells. The concentration and purity of the RNA solution were determined by ultraviolet spectrophotometry at 260 nm and 280 nm. A single cDNA template targeting TNF-α, IL-1β, IL-6, TLR4, NF-κB, LXRα, ABCA1, ABCG, specific primers were synthesized by reverse transcription design based on a known sequence of β-actin. Real-time quantitative PCR was performed using the ABI PRISM 7500 processing system. For each gene to be measured, a cDNA template and sample cDNA defining the expressed gene is selected for the PCR reaction. There are 40 cycles, such as 95 °C for 15 s, 60 ℃ for 60 s, and 72 °C for 20 s. Each experiment was repeated three times and each sample was repeated three times. The β-actin was used as an endogenous internal standard control.2.12. ELISA assayThe double sandwich antibody method was used to detect the concentration of IL-1β, IL-6, IL-10, and TNF-α in mouse tissues and Primary mouse lung cells. The tissues were weighed and rinsed with pre-chilled PBS. The tissue was ground with PBS (Simple: PBS=1:9) thoroughly with a glass homogenizer. The supernatant was taken after being centrifuged at 5000 rpm for 10 min. The cell culture supernatant was 2000rpm for 20 min to remove impurities and cell debris. The supernatant was tested. The anti-mouse antibody is coated on the ELISA plate. The cell factor in the sample was combined with the anti-mouse antibody. Then the horseradish peroxidase-labeled antibody is added, and the chromogenic substrate TMB is added. After the stop reaction solution was added. To measure the OD value with a microplate reader at 450nm wavelength. We can calculate the cytokine concentration in the sample by drawing a standard curve.2.13. Western blot analysis Total protein was extracted from mouse lung tissue and primary mouse lung cells. The protein concentration was determined by the BCA method. Separate the sample using an agarose SDS gel and transfer it to the NC membrane. The membrane was blocked with Tris-buffered saline (TBST) containing 5% skim milk at room temperature for 2 hours and then incubated with a specific primary antibody (1:1000) overnight. Subsequently, the membrane was washed with TBST and then incubated with a secondary antibody at room temperature for 1 hour. Wash the batch with TBST again, and then use BCL luminescent color developing solution to take pictures under the imaging system to analyze the brightness.2.14. Statistical analysis SPSS Statistical 19 was used for statistical analysis. The statistics are represented by an average of ± S.E.M. for three separate experiments. Differences between groups were analyzed by Two-factor analysis of variance or Student t test. # p < 0.05 vs. the control group, ## p < 0.01 vs. the LPS group, ### p < 0.001 vs. the LPS group, #### p < 0.0001 vs. the LPS group；* p < 0.05 vs. the LPS group, ** p < 0.01 vs. the LPS group, *** p < 0.001 vs. the LPS group, **** p < 0.0001 vs. the LPS group.3. Results3.1. Lycorine attenuates LPS-induced ALI in miceIn this study, HE staining was used to evaluate pathological changes. ELISA was used to detect MPO activity and inflammatory factors. As shown in Fig. 1A, CG histopathological analysis showed standard lung structure. The lung slices of mice after LPS stimulation showed typical histological changes, including inflammatory cell infiltration, thickening of alveolar walls, interstitial edema, and pulmonary congestion (Fig. 1E). However, 20, 40, and 80 groups significantly alleviated the historical changes caused by LPS administration (Fig. 1B-D). And the higher the concentration of lycorine, the more significant the effect. It is shown in Fig. 1F. MPO activity was significantly increased in the LPS group compared with CG. The content of MPO in Groups 20, 40, and 80 was lower than the LPS group but still higher than CG. The sandwich ELISA method measured the concentration of TNF-α, IL-1β, and IL-6 in lung tissue. Compared with CG, stimulating cells with LPS without lycorine treatment will significantly increase cytokine production (Fig. 1G-I). After the cells were treated with lycorine (20, 40, 80 mg/L), TNF-α, IL-1β, and IL-6 in the LPS group were significantly lower than in the LPS group.3.2. Effect of lycorine on TLR4/NF-κB signaling pathway and lipid raftWe used the immunofluorescence method to analyze membrane lipid rafts and p65 protein. Western Blot and qPCR detected the level of proteins and mRNA related to the TLR4/NF-κB signaling pathway. The result is shown in Fig. 2. The level of lipid raft in lung tissue of mice in the LPS group was significantly higher than that in the CG. the degree of lipid raft in the group treated with lycorine was reduced considerably compared with the LPS group (Fig. 2A-F). As shown in Fig. 2G-I, mRNA levels of TLR4, IκBα, and NF-κB p65 were not entirely different among all groups. Fig. 2J-Q shows the protein expression of each group. Compared with CG, the protein expression of TLR4 in the LPS group was increased, and the protein phosphorylation levels of IκBα and NF-κB p65 were significantly increased. Compared with the LPS group, the protein phosphorylation level and TLR4 expression level of histones 20, 40, and 80 decreased successively. Translocation of p65 protein in lung tissue of mice in the LPS group was significantly higher than that in the CG (Fig. 2R-W). The translocation of p65 protein in the group treated with lycorine was considerably reduced compared with the LPS group. The results showed that lycorine could destabilize lipid rafts and reduce LPS-induced inflammatory response.3.3. Effects of lycorine on membrane cholesterol and LXRα signal.Lycorine interacts with LXRα mainly through hydrogen bond formation and hydrophobic force. It forms a hydrogen bond with His419 (B); the hydrogen bond length is 2.98 A. It has a hydrophobic effect with Met296 (B), Trp441 (B), Ile293 (B), Ala259 (B), Leu297 (B), Thr300 (B), Leu329 (B), Phe255 (B), Phe252 (B) and Val423 (B). The binding energy of lycorine to LXRα was -8.2kcal/mol, which proved that lycorine had a good binding effect (Fig. 3A). Cholesterol content was detected using the Nanjing Jiancheng cholesterol testing kit. Western Blot and qPCR were used to detect LXRα signal-related protein and mRNA levels. Cholesterol levels did not change significantly in the LPS group compared with CG but significantly decreased in the lycorine group (Fig. 3B). The protein expressions of LXRα, ABCA1 and ABCG in the lycorine group were significantly increased compared with CG and LPS groups (Fig. 3C). The higher the lycorine dose was, the more significant the effect was (Fig. 3D-F). As shown in Fig. 3G-I, the mRNA levels of LXRα increased in both LPS and lycorine groups (20, 40, 80) compared with CG. The mRNA of ABCA1 and ABCG were significantly increased in the lycorine group compared with CG and LPS. The results showed that lycorine up-regulated the expression of LXRα. And it activated ABCA1 and ABCG pathways and promoted the leakage of cholesterol.3.4. Lycorine inhibits the secretion of inflammatory factors by regulating TLR4/NF-κB signaling pathwayThe mRNA levels of TNF-α, IL-1β, and IL-6 in primary mouse lung cells and the concentrations of TNF-α, IL-1β, and IL-6 in cell culture supernatant were detected. LPS stimulation of cells without lycorine treatment resulted in a significant increase in mRNA levels and concentrations of cytokines compared to CCG. The mRNA levels and contents of TNF-α, IL-1β, and IL-6 in the lycorine group (C20, C40, C80) were significantly lower than those in the LPS group. The concentrations of TNF-α, IL-1β, and IL-6 in the supernatant of the primary mouse lung cells culture were determined by sandwich ELISA. LPS stimulation of cells without lycorine treatment resulted in a significant increase in cytokine production compared to CCG. The levels of inflammatory cytokines such as TNF-α, IL-1β, and IL-6 in the lycorine group (C20, C40, and C80) were significantly lower than those in the LPS group (Fig. 4A-B). As shown in Fig. 4C, there was no significant difference in mRNA expression of TLR4, IκBα, and NF-κB p65 among all groups in cells. The protein expression levels of each group are shown in Fig. 4D-K. Compared with CG, the expression of the protein phosphorylation levels of IκBα and NF-κB P65 were significantly increased in the LPS group. Compared with the LPS group, the protein phosphorylation level expression level of C20, C40 and C80 decreased successively. The protein expression level of TLR4 had no significant change. The results showed that lycorine could reduce the inflammatory response induced by lipopolysaccharide by regulating TLR4/NF-κB signaling pathway. 3.5. Lycorine activates LXRα signal by increasing LXRα activityIn this study, qPCR and Western blot detected mRNA and protein levels of LXRα, ABCA1, and ABCG. Luciferase gene assay was used to determine whether lycorine could enhance LXRα activity. The result is shown in Fig. 5. LXRα mRNA and protein levels in lycorine group were not significantly increased compared with CCG (Fig.s 5A and 5E). The mRNA and protein expressions of ABCA1 and ABCG were increased dramatically in a dose-dependent manner compared with the control group (Fig. 5B-C, 5E). The activity of LXRα in the lycorine group was significantly increased compared with that of CCG, and the effect was more significant with increasing dose (Fig.s 5D). The protein ratio analysis of LXRα, ABCA1, and ABCG is shown in Fig. 5F-H. The results showed that lycorine activated the LXRα signal and promoted protein expression of ABCA1 and ABCG by enhancing LXRα transcriptional activity.3.6. The anti-inflammatory effect of lycorine was weakened by inhibiting LXRα activity In this study, we detected intracellular LXRα activity, protein levels of cholesterol, LXRα signaling pathway, TLR4/NF-κB signaling pathway, and inflammatory factors after the addition of GSK2033. The result is shown in Fig. 6. After the addition of GSK2033, the activity of LXRα in the lycorine group was significantly inhibited compared with CCG, but the cholesterol content was increased considerably(Fig. 6A-B). The protein level of LXRα in lycorine group was significantly increased compared with CCG (Fig. 6C-I). Protein expression of ABCA1 and ABCG was reduced considerably compared with CCG. The levels of IκBα and NF-κB p65 and phosphorylation were significantly increased. As shown in Fig. 7J, the contents of TNF-α and IL-1β increased considerably, and the range of IL-6 was significantly increased. The results showed that the anti-inflammatory effect of lycorine was weakened after the activity of LXRα was inhibited. 4. DiscussionThis study aims to investigate the mechanism by which lycorine exerts a protective role in mitigating acute lung injury in mice. ALI is a respiratory disease with a high fatality rate that can be caused by a variety of reasons(Li et al. , 2021a, Zhu et al. , 2021b). In recent years, due to the spread of COVID-19, humans have paid more attention to such respiratory diseases. The special ingredients in traditional Chinese medicine seem to be able to play a role in the treatment of such diseases. Lycorine, an alkaloid found in the bulbs of Lycoris Radiata, has been proven to have anti-inflammatory effects(de Queiroz Souza et al. , 2021, Ge et al. , 2020). In this study, we used a variety of molecular biology techniques, including histopathological analysis, Western blotting, qPCR, and ELISA, to investigate whether lycorine has a protective effect on LPS-induced mice ALI (Qiu et al. , 2021, Yao et al. , 2021, Zhu et al. , 2021a). The pathological results showed that the experimental model was established successfully. Compared with LPS group, the pathological injury degree of lycorine in lung tissue sections was reduced, and inflammatory cell infiltration was reduced. ELISA results also showed that after lycorine treatment, the secretion of inflammatory factors TNF-α, IL-1β and IL-6 decreased, and the activity of MPO decreased. This confirmed the protective effect of lycorine on LPS-induced ALI(Cui et al. , 2023). TLR4 is a key receptor for LPS transmembrane signal transduction. Lipid rafts are signal transduction platforms on cell membranes. The stability of lipid raft is closely related to TLR4(Amine et al. , 2021, da Cruz et al. , 2021, Park et al. , 2021). After LPS stimulation of lung tissues and cells, TLR4 is recruited into lipid rafts to induce downstream signal transduction(Chen et al. , 2020b, Wei et al. , 2016). It has shown that TLR4 recruitment into lipid rafts can be inhibited using drugs by interfering with lipid raft formation (cholesterol consumption)(Dolganiuc et al. , 2006). It reduces lipopolysaccharide-induced NF-κB activation and inflammatory cytokine production(Kang et al. , 2020, Xu et al. , 2023a, Xu et al. , 2023c). Our results suggest that lycorine can inhibit the transfer of TLR4 to lipid rafts by destroying lipid rafts by consuming cholesterol. Next, we investigated why lycorine reduces cholesterol levels in lipid rafts. AutoDock software was used to calculate the binding force of lycorine and LXRα. The results showed that lycorine and LXRα had good binding force. LXRα plays an important role in the regulation of cholesterol homeostasis. This makes the inference that lycorine acts as a cholesterol-depleting agent by regulating LXRα function more plausible.Previous studies have confirmed that LXRα can mediate the expression of ABCA1 and ABCG and regulate intracellular cholesterol levels. We tested our hypothesis in cells: Lycorine plays an anti-inflammatory role by promoting intracellular cholesterol efflux through regulation of LXRα signaling, thereby disrupting lipid rafts and inhibiting the activation of TLR4/NF-κB signaling pathway. We extracted mouse primary lung cells and stimulated them with LPS to activate the TLR4/NF-κB signaling pathway and promote the secretion of inflammatory factors. The results showed that the expressions of TNF-α, IL-1β and IL-6 in primary lung cells of mice were significantly increased after LPS treatment. The expression levels of TNF-α, IL-1β and IL-6 in lycorine group decreased compared with LPS group, and the higher the concentration of lycorine, the more obvious the effect was. However, the gene expression levels of TLR4, IκBα and p65 were not significantly affected. Compared with LPS group, lycorine reduced the phosphorylation levels of p-IκBα and p-p65 proteins. This suggests that lycorine reduces LPS-induced cytokine production by inhibiting the activation of the TLR4/NF-κB signaling pathway. This is consistent with the results of in vivo experiments.Since lycorine has no significant effect on TLR4 gene and protein level in vivo and in vitro, how does it inhibit the activation of TLR4/NF-κB signaling pathway? We came up with the idea of looking for the answer from the TLR4 bearing platform - lipid raft. Figure 2 (A-E) immunofluorescence staining of lipid raft proved that lycorine treatment did indeed reduce the formation of lipid raft induced by LPS(Miller et al. , 2020). Cholesterol is a key component of lipid rafts. Therefore, we investigated the effect of lycorine on the activation of LXRα, ABCA1 and ABCG (Figure 5). It was found that different concentrations of lycorine had no significant effect on the mRNA expression of LXRα, but promoted the mRNA expression of ABCA1 and ABCG in a dose-dependent manner. Therefore, the activity of LXRα was tested in this study, and it was found that lycorine enhanced the activity of LXRα. At the protein level, lycorine promoted the expression of LXRα, ABCA1 and ABCG. This suggests that lycorine induces the expression of ABCA1 and ABCG by activating LXRα. In order to further verify our conclusion, we conducted the LXRα activity inhibition experiment. After the addition of GSK2033, the activity of LXRα was inhibited, the content of cellular cholesterol was increased, the protein expression levels of ABCA1 and ABCG were increased, and the anti-inflammatory effect of lycorine was weakened. These results suggest that the binding of lycorine with LXRα may promote the activation of LXRα, and inhibition of LXRα activity may reduce the anti-inflammatory effect of lycorine.5. ConclusionIn summary, lycorine can reduce LPS-induced acute lung injury in mice, and its anti-inflammatory mechanism is related to the activation of LXRα-ABCA1/ABCG pathway, the consumption of cholesterol, the destruction of lipid rafts, and the inhibition of the activation of TLR4/NF-κB signaling pathway. 6. Glossary ALI Acute lung injury COVID-19 Corona Virus Disease 2019 LPS Lipopolysaccharide TLR Toll like receptor NF-κB nuclear factor kappa-B IκB inhibitor of NF-κB LXR liver X receptor ABCG Adenosine triphosphate–binding cassette subfamily G ABCA1 ATP-binding cassette transporter A1 ROS reactive oxygen species MMP mitochondrial membrane potential SASP senescence-associated secretion phenotype MPO Myeloperoxidase TNF-α tumor necrosis factor-α IL Interleukin 7. AcknowledgementsThe authors gratefully acknowledge Professor Guo from Northeast Agricultural University for providing financial support and experimental technical analysis for this study.8. Conflict of interestThe authors declare that there are no conflicts of interest.9. Author contributionsFuhan Wang: Conceptualization, Methodology, Software, Writing- Original draft preparation. Xiaohan Li: Data curation. Kan Li: Visualization. Jilong Luo: Investigation. Yao Xue: Supervision. Ziyi Li: Software, Validation. Bing Zhao: Writing- Reviewing and Editing. Xue-jiao Gao: Writing- Reviewing and Editing.10. Data accessibility statementAll data, models, or code generated or used during the study are available from the corresponding author by request.11. FundingsNatural Science Foundation of Heilongjiang Province (LH2023C028) 12. ReferencesAdebiyi A, Soni H, John TA, Yang F. Lipid rafts are required for signal transduction by angiotensin II receptor type 1 in neonatal glomerular mesangial cells. Exp Cell Res. 2014;324:92-104.Alikiaii B, Bagherniya M, Askari G, Johnston TP, Sahebkar A. The role of phytochemicals in sepsis: A mechanistic and therapeutic perspective. Biofactors. 2021;47:19-40.Amine H, Benomar Y, Taouis M. Palmitic acid promotes resistin-induced insulin resistance and inflammation in SH-SY5Y human neuroblastoma (vol 11, 5427, 2021). Sci Rep-Uk. 2021;11.Chen H, Lao Z, Xu J, Li Z, Long H, Li D, et al. Antiviral activity of lycorine against Zika virus in vivo and in vitro. Virology. 2020a;546:88-97.Chen Y, Zhao YF, Yang J, Jing HY, Liang W, Chen MY, et al. Selenium alleviates lipopolysaccharide-induced endometritis via regulating the recruitment of TLR4 into lipid rafts in mice. Food Funct. 2020b;11:200-10.Colardo M, Martella N, Pensabene D, Siteni S, Di Bartolomeo S, Pallottini V, et al. Neurotrophins as Key Regulators of Cell Metabolism: Implications for Cholesterol Homeostasis. Int J Mol Sci. 2021;22.Cui J, Xu T, Lv H, Guo M-y. Zinc deficiency causes oxidative stress, endoplasmic reticulum stress, apoptosis and inflammation in hepatocytes in grass carp. Fish & Shellfish Immunology. 2023;139.D'Aprile C, Prioni S, Mauri L, Prinetti A, Grassi S. Lipid rafts as platforms for sphingosine 1-phosphate metabolism and signalling. Cell Signal. 2021;80.da Cruz LLP, de Souza PO, Dal Pra M, Falchetti M, de Abreu AM, Azambuja JH, et al. TLR4 expression and functionality are downregulated in glioblastoma cells and in tumor-associated macrophages: A new mechanism of immune evasion? Biochimica Et Biophysica Acta-Molecular Basis of Disease. 2021;1867.de Queiroz Souza AS, Costa de Sousa JA, Pinto CS, Alves Filho EG, Alves Pereira RdC, de Brito ES, et al. Untargeted GC/MS-based approach for identification of anti-inflammatory alkaloids from Hippeastrum elegans (Amaryllidaceae) using a human neutrophil model. Journal of Pharmaceutical and Biomedical Analysis. 2021;199.Dolganiuc A, Bakis G, Kodys K, Mandrekar P, Szabo G. Acute ethanol treatment modulates Toll-like receptor-4 association with lipid rafts. Alcohol Clin Exp Res. 2006;30:76-85.Ge X, Meng XL, Fei DS, Kang K, Wang QB, Zhao MY. Lycorine attenuates lipopolysaccharide-induced acute lung injury through the HMGB1/TLRs/NF-kappa B pathway. 3 Biotech. 2020;10.Gross CM, Kovacs-Kasa A, Meadows ML, Cherian-Shaw M, Fulton DJ, Verin AD. Adenosine and ATP gamma S protect against bacterial pneumonia-induced acute lung injury. Sci Rep-Uk. 2020;10.Hammer SS, Vieira CP, McFarland D, Sandler M, Levitsky Y, Dorweiler TF, et al. Fasting and fasting-mimicking treatment activate SIRT1/LXR alpha and alleviate diabetes-induced systemic and microvascular dysfunction. Diabetologia. 2021;64:1674-89.Holani R, Babbar A, Blyth GAD, Lopes F, Jijon H, McKay DM, et al. Cathelicidin-mediated lipopolysaccharide signaling via intracellular TLR4 in colonic epithelial cells evokes CXCL8 production. Gut Microbes. 2020;12.Hu WJ, Wang YB, Cheng B, Xu LY, Zhou Y, Wu LD. Protective effect of electrical stimulation of the vagus nerve in lipopolysaccharide-induced acute lung injury in rats. Mol Med Rep. 2021;23.Jing H, Zhang Q, Li S, Gao X-j. Pb exposure triggers MAPK-dependent inflammation by activating oxidative stress and miRNA-155 expression in carp head kidney. Fish & Shellfish Immunology. 2020;106:219-27.Kaelberer MM, Caceres AI, Jordt SE. Activation of a nerve injury transcriptional signature in airway-innervating sensory neurons after lipopolysaccharide-induced lung inflammation. Am J Physiol-Lung C. 2020;318:L953-L64.Kang XH, Li PH, Zhang CB, Zhao YS, Hu HL, Wen GL. The TLR4/ERK/PD-L1 axis may contribute to NSCLC initiation. Int J Oncol. 2020;57:456-65.Kongkwamcharoen C, Itharat A, Pipatrattanaseree W, Ooraikul B. Effects of Various Preextraction Treatments of Crinum asiaticum Leaf on Its Anti-Inflammatory Activity and Chemical Properties. Evid-Based Compl Alt. 2021;2021.Li C, Deng C, Pan G, Wang X, Zhang K, Dong Z, et al. Lycorine hydrochloride inhibits cell proliferation and induces apoptosis through promoting FBXW7-MCL1 axis in gastric cancer (vol 39, 230, 2020). Journal of Experimental & Clinical Cancer Research. 2022;41.Li L, Qu MJ, Yang L, Liu J, Wang Q, Zhong PR, et al. Effects of Ultrashort Wave Therapy on Inflammation and Macrophage Polarization after Acute Lung Injury in Rats. Bioelectromagnetics. 2021a;42:464-72.Li M-H, Liao X, Li C, Wang T-T, Sun Y-S, Yang K, et al. Lycorine hydrochloride induces reactive oxygen species-mediated apoptosis via the mitochondrial apoptotic pathway and the JNK signaling pathway in the oral squamous cell carcinoma HSC-3 cell line. Oncology Letters. 2021b;21.Liao S, Liu S, Zhang Y. Preparation of Anti Toll-Like Receptor-4 Nano-Antibody and Its Effect on Gram Negative Sepsis. Journal of nanoscience and nanotechnology. 2021;21:1048-53.Liu B, He ZQ, Wang JJ, Xin ZY, Wang JX, Li F, et al. Taraxasterol Inhibits LPS-Induced Inflammatory Response in BV2 Microglia Cells by Activating LXR alpha. Front Pharmacol. 2018;9.Liu W-y, Tang Q, Zhang Q, Hu C-p, Huang J-b, Sheng F-f, et al. Lycorine Induces Mitochondria-Dependent Apoptosis in Hepatoblastoma HepG2 Cells Through ROCK1 Activation. Front Pharmacol. 2019;10.Miller YI, Navia-Pelaez JM, Corr M, Yaksh TL. Lipid rafts in glial cells: role in neuroinflammation and pain processing: Thematic Review Series: Biology of Lipid Rafts. Journal of lipid research. 2020;61:655-66.Novoselova EG, Lunin SM, Khrenov MO, Parfenyuk SB, Novoselova TV, Shenkman BS, et al. Changes in immune cell signalling, apoptosis and stress response functions in mice returned from the BION-M1 mission in space. Immunobiology. 2015;220:500-9.Park C, Cha H-J, Lee H, Kim G-Y, Choi YH. The regulation of the TLR4/NF-kappa B and Nrf2/HO-1 signaling pathways is involved in the inhibition of lipopolysaccharide-induced inflammation and oxidative reactions by morroniside in RAW 264.7 macrophages. Archives of Biochemistry and Biophysics. 2021;706.Qiu XT, Luo JM, Fang LH. AIBP, Angiogenesis, Hematopoiesis, and Atherogenesis. Curr Atheroscler Rep. 2021;23.Shang H, Jang XN, Shi LY, Ma YF. Lycorine inhibits cell proliferation and induced oxidative stress-mediated apoptosis via regulation of the JAK/STAT3 signaling pathway in HT-3 cells. J Biochem Mol Toxic. 2021;35.Shi JL, Chen QY, Yu WK, Shen JH, Gong JF, He CS, et al. Continuous Renal Replacement Therapy Reduces the Systemic and Pulmonary Inflammation Induced by Venovenous Extracorporeal Membrane Oxygenation in a Porcine Model. Artif Organs. 2014;38:215-23.Singh DP, Begum R, Kaur G, Bagam P, Kambiranda D, Singh R, et al. E-cig vapor condensate alters proteome and lipid profiles of membrane rafts: impact on inflammatory responses in A549 cells. Cell Biol Toxicol. 2021;37:773-93.Song XY, Yan GL, Wang HH, Lou DF. Septin 4 activates PPAR gamma/LXR alpha signaling by upregulating ABCA1 and ABCG1 expression to inhibit the formation of THP-1 macrophage-derived foam cells. Exp Ther Med. 2021;22.Suzuki KGN. Lipid rafts generate digital-like signal transduction in cell plasma membranes. Biotechnol J. 2012;7:753-61.Vitiello G, Oliva R, Petraccone L, Del Vecchio P, Heenan RK, Molinaro A, et al. Covalently bonded hopanoid-Lipid A from Bradyrhizobium: The role of unusual molecular structure and calcium ions in regulating the lipid bilayers organization. J Colloid Interf Sci. 2021;594:891-901.Wan YW, Liu W, Feng MT, Pu J, Zhuang SW, He B, et al. LXR beta is involved in the control of platelet production from megakaryocytes. Blood Cell Mol Dis. 2021;89.Wang F, Xia Z-F, Chen X-L, Jia Y-T, Wang Y-J, Ma B. Angiotensin II type-1 receptor antagonist attenuates LPS-induced acute lung injury. Cytokine. 2009;48:246-53.Wang HC, Wu CH, Kong DH. miR-140-5p Overexpression Protects Against Lipopolysaccharide-Induced Necrotizing Pneumonia via Targeting Toll-Like Receptor 4. Cell Mol Bioeng. 2021;14:339-48.Wei ZK, Wang JJ, Shi MY, Liu WJ, Yang ZT, Fu YH. Saikosaponin a inhibits LPS-induced inflammatory response by inducing liver X receptor alpha activation in primary mouse macrophages. Oncotarget. 2016;7:48995-9007.Xu R, Cao J-w, Xu T-c, Liu T-j, Zhu M-r, Guo M-y. Selenium deficiency induced inflammation and apoptosis via NF-KB and MAPKs pathways in muscle of common carp (Cyprinus carpio L.). Fish & Shellfish Immunology. 2023a;138.Xu S, Sun X, Wu J, Li K, Li X, Zhang Y, et al. TBBPA causes inflammation and cell death via the ROS/NF-& kappa;B pathway in the gastric mucosa. Ecotoxicology and Environmental Safety. 2023b;262.Xu T, Cui J, Xu R, Cao J, Guo M-y. Microplastics induced inflammation and apoptosis via ferroptosis and the NF-KB pathway in carp. Aquatic Toxicology. 2023c;262.Xu Y, Li A, Li X, Deng X, Gao X-j. Zinc Deficiency Induces Inflammation and Apoptosis via Oxidative Stress in the Kidneys of Mice. Biological Trace Element Research. 2023d;201:739-50.Yao WJ, Xu L, Jia XB, Li SS, Wei L. MicroRNA-129 plays a protective role in sepsis-induced acute lung injury through the suppression of pulmonary inflammation via the modulation of the TAK1/NF-kappa B pathway. Int J Mol Med. 2021;48.Zhang JG, Huang X, Ding DY, Zhang JH, Xu LS, Hu ZK, et al. Comparative Study of Acute Lung Injury in COVID-19 and Non-COVID-19 Patients. Frontiers in Medicine. 2021a;8.Zhang Q, Wang F, Xu S, Cui J, Li K, Xu S, et al. Polystyrene microplastics induce myocardial inflammation and cell death via the TLR4/NF-?B pathway in carp. Fish & Shellfish Immunology. 2023;135.Zhang WN, Yang JQ, Chen Y, Xue RH, Mao ZY, Lu W, et al. Lycorine hydrochloride suppresses stress-induced premature cellular senescence by stabilizing the genome of human cells. Aging Cell. 2021b;20.Zhu SM, Huang SQ, Xia GF, Wu J, Shen Y, Wang Y, et al. Anti-inflammatory effects of alpha 7-nicotinic ACh receptors are exerted through interactions with adenylyl cyclase-6. Brit J Pharmacol. 2021a;178:2324-38.Zhu YB, Wang YY, Xing SG, Xiong J. Blocking SNHG14 Antagonizes Lipopolysaccharides-Induced Acute Lung Injury via SNHG14/miR-124-3p Axis. J Surg Res. 2021b;263:140-50. Table 1 TLR4 Forward: 5′- GCCATCATTATGAGTGCCAATT -3′ Reverse: 5′- AGGGATAAGAACGCTGAGAATT -3′ NF-κB p65 Forward:5′- CCATAGCCATAGTTGCGGTCCTTC -3′ Reverse: 5′- CGTTCTTCCCTCCCTTTTCCTTTCC -3′ IκB-α Forward:5′- GAATCACCAGAACATCGTGAAG -3′ Reverse: 5′- CAGTACTCCATGATTAGCACCT -3′ LXRα Forward:5′- AGTTGTGGAAGACAGAACCTCAAGATG -3′ Reverse: 5′- TGCTGACTCCAACCCTATCCCTAAAG -3′ ABCG Forward:5′- CCTGACACATCTGCGAATCACCTC -3′ Reverse: 5′- AACAGCATGGAGAAGAACAGGAAGC -3′ ABCA1 Forward:5′- TTGAATGACGAGGATGAGGATGT -3′ Reverse: 5′- TTGTTGCCGCCACTGTAGTTA -3′ IL-1β Forward: 5′- TTCCCA TTAGACAACTGC -3′ Reverse: 5′- CTGTAGTGTTGTATGTGATC -3′ IL-6 Forward: 5′- CAGAACCGCAGTGAAGAG -3′ Reverse: 5′- CAGAACCGCAGTGAAGAG -3′ TNF-α Forward:5′- CTCA TTCCTGCTTGTGGC -3′ Reverse: 5′- CACTTGGTGGTTTGCTACG -3′ β-actin Forward:5′- CTACCTCATGAAGATCCTGACC -3′ Reverse: 5′- CACAGCTTCTCTTTGATGTCAC -3′ Fig. legendsFig. 1: Histological analysis and inflammatory factor detection. (A-E) Histopathology of lung tissue. (A) Lung tissue control group (CG). (B-D) Lycorine administration group (80, 40, 20 mg/kg, respectively). (E) LPS treatment group (LPS). (F) Myeloperoxidase activity in lung tissue. (G) The TNF-α protein level in lung tissue. (H) The IL-1β protein level in lung tissue. (I) The IL-6 protein level in lung tissue. Data represent the contents of 1 mL of supernatant of lung tissue homogenate (n = 10). *p < 0.05, significantly different from the CG; #p < 0.05, significantly different from the LPS group.Fig. 2: Effects of allicin on TLR4/NF-κB signaling pathway and lipid raft in lung tissue. (A-E) Immunohistochemistry of flotillin-1 protein was performed on paraffin sections, enabling lipid rafts to be observed under electron microscopy. (A) Control group (CG); (B-D) lycorine administration groups (80, 40 and 20 mg/kg, respectively); (E) LPS treatment group (LPS). (F) Immunofluorescence relative intensity of Flotillin-1. The mRNA and protein levels of TLR4, IκBα, and NF-κB p65 were detected by qPCR and Western blot. (G) The mRNA level of TLR4; (H) The mRNA level of IκBα; (I) The mRNA level of NF-κB p65. (J) The protein levels of TLR4, IκBα, phosphorylated IκBα, p65, and phosphorylated p65 were detected. β-actin was used as a control; (K-Q) The relative intensities of TLR4 and IκBα, p-IκB α, p65, and p-p65. (R-V) Immunohistochemistry of NF-κB p65 protein was performed on paraffin sections so that the nuclear translocation of p65 protein could be observed by electron microscopy. (R) Control group (CG); (S-U) lycorine administration groups (80, 40 and 20 mg/kg, respectively); (V) LPS treatment group (LPS). (W) Immunofluorescence relative intensity of p65. *: p<0.05, **: p<0.01，***: p<0.001, ****: p<0.0001, significantly different from CG; #: p <0.05, ##: p<0.01，###: p<0.001, ####: p<0.0001. significantly different from LPS group.Fig. 3: Effects of lycorine on membrane cholesterol and LXRα signal. (A) The binding sites of lycorine and LXRα. (B) Cholesterol levels of lipid raft in lung tissue. (C) The levels of LXRα, ABCA1, and ABCG proteins in lung tissues were detected by Western blotting. β-actin was used as a control. (D-F) The relative intensities of LXRα, ABCA1, and ABCG; (G)The mRNA level of LXRα; (H) The mRNA level of ABCA1; (I) The mRNA level of ABCG. CG, control group; lycorine administration groups (80, 40, and 20 mg/kg, respectively); LPS, LPS treatment group. *: p<0.05, **: p<0.01，***: p<0.001, ****: p<0.0001, significantly different from CG; #: p <0.05, ##: p<0.01，###: p<0.001, ####: p<0.0001. significantly different from LPS group.Fig. 4: Lycorine inhibits the secretion of inflammatory factors by regulating TLR4/NF-κB signaling pathway. (A) The mRNA level of inflammatory factors; (B) The inflammatory factor levels; (C) mRNA level of TLR4/p65 pathway; (D) The levels of TLR4, IκBα, phosphorylated IκBα, p65, phosphorylated p65 were detected by Western blotting. β -actin was used as a control. (E-K) The relative intensities of TLR4 and IκBα, p-IκB α, p65, and p-p65 (n = 3). CCG, control group; lycorine administration groups (80, 40, and 20 mg/kg, respectively); LPS, LPS treatment group. *: p<0.05, **: p<0.01，***: p<0.001, ****: p<0.0001, significantly different from CCG; #: p <0.05, ##: p<0.01，###: p<0.001, ####: p<0.0001. significantly different from LPS group. Fig. 5: Lycorine activates LXRα signal by increasing LXRα activity. (A) The mRNA level of LXRα. (B) The mRNA level of ABCA1. (C) The mRNA level of ABCG. (D) The activity of LXRα. (E) The levels of LXRα, ABCA1 and ABCG were detected by Western blotting. β -actin was used as a control. (F-H) The relative intensities of LXRα, ABCA1 and ABCG. CCG, control group; lycorine administration groups (80, 40, and 20 mg/kg, respectively). *: p<0.05, **: p<0.01，***: p<0.001, ****: p<0.0001, significantly different from CG; #: p <0.05, ##: p<0.01，###: p<0.001, ####: p<0.0001. significantly different from LPS group.Fig. 6: The anti-inflammatory effect of lycorine was weakened by inhibiting LXRα activity. (A) Lipid raft cholesterol level of primary mouse lung cells after the addition of inhibitors. (B) Effects of lycorine on LXRα activity after addition of inhibitor. (C) The protein levels of LXRα, ABCA1, ABCG, TLR4, phosphorylated IκBα, and phosphorylated p65 by western blot analysis in primary mouse lung cells after inhibitor addition. β-actin was used as the control group. (D-I) The relative intensities of LXRα, ABCA1, ABCG, TLR4，p-IκBα, and p-p65. (J) The inflammatory factors levels after the addition of inhibitors. CCG, control group; Lycorine administration group (80, 40, 20 mg/kg); LPS, LPS treatment group. *: p<0.05, **: p<0.01，***: p<0.001, ****: p<0.0001, significantly different from CCG. Graphical Abstract：Schematic illustration of the mechanism by which Lycorine destabilizes lipid rafts to inhibit inflammation via LXRα signal in the lung. ① LPS induced acute lung injury in mice. ② Mechanism of lycorine's anti-inflammatory effect. ③ Diagram of the mechanism of LPS-induced inflammation. ④ GSK2033 inhibits the anti-inflammatory effects of lycorin by inhibiting LXRα activity.Table 1: Primer sequence table
