Low temperature restricts the growth, development, and yield of peppers, significantly limiting the development of the pepper industry. NAC (NAM, ATAF1/2, and CUC2) transcription factors (TFs) are implicated in plant responses to cold stress, but their specific mechanisms in peppers are unclear. In this study, we isolated a cold-induced NAC transcription factor, CaNAC76, from pepper (Capsicum annuum L.). CaNAC76 is localized in the nucleus and cytoplasm and exhibits transcriptional activation activity. Silencing CaNAC76 expression reduced the activities of superoxide dismutase, peroxidase, and catalase enzymes, resulting in decreased cold tolerance in peppers. Conversely, overexpressing CaNAC76 increased the activities of antioxidant enzymes and the expression of cold stress-responsive genes (ICE-CBF-COR) in Arabidopsis, enhancing the plant’s freezing tolerance. Transcriptional regulation analysis showed that CaNAC76 directly binds to the promoter region of CaCAD1 and induces its expression. Similarly, low temperatures induced the expression of CaCAD1. Ectopic expression of CaCAD1 improved Arabidopsis freezing tolerance, whereas silencing CaCAD1 expression increased sensitivity to low temperatures. Furthermore, we observed that CaNAC76 overexpression enhanced CAD activity and lignin content in Arabidopsis, leading to lignin deposition in the xylem and interfascicular fibers. In summary, the results demonstrate that CaNAC76 can enhance cold tolerance in peppers by affecting both CBF-dependent (ICE-CBF-COR) and CBF-independent pathways (promoting CaCAD1 expression).Key words：Pepper; Cold; Lignin; CaNAC76; CaCAD11 IntroductionLow temperature constitutes a principal environmental constraint that limits plant growth, development, yield, and geographical distribution [1]. As sessile organisms, plants have evolved complex and diverse mechanisms to withstand and adapt to cold stress. These mechanisms include activating reactive oxygen species (ROS) scavenging systems, altering lipid composition to maintain membrane stability, and producing osmoprotectants such as sucrose, proline, and antifreeze proteins [2-4]. These adaptations predominantly involve changes in gene expression, particularly the regulation of COR genes [5-7]. COR genes are downstream responsive genes in the cold signaling pathway. Different transcription factors (TFs) regulate the transcription levels of these genes by binding specifically to cis-acting elements in promoters, thereby controlling target gene expression [7,8]. Among the TFs currently known to be involved in cold response are AP2/ERF, NAC, WRKY, MYB, bZIP, and ZFPs [9-11].Plant NAC proteins (NAM, ATAF1/2, and CUC2) feature a DNA-binding domain at their N-terminus and a variable transcription regulatory region (TRR) at their C-terminus [10]. Several NAC TFs have been implicated in mediating plant responses to cold stress. For example, the soybean gene GmNAC20 enhances cold tolerance in transgenic Arabidopsis [12]. PbeNAC1 in pears and VvNAC1 in grapes increase tolerance to cold stress in these two species [13,14]. Ma et al demonstrated that SINAC1 boosts cold tolerance in genetically modified tomato plants through regulation of the ROS equilibrium [15].When exposed to low temperatures, plants undergo extensive transcription, translation, and post-translational changes to activate intricate molecular mechanisms in response to cold stress [5]. One of the widely explored mechanisms is the cold signaling pathway dependent on the C-repeat Binding Factor (CBF) [1,16]. CBF1 and CBF3 in Arabidopsis can be rapidly activated within 15 minutes of cold exposure, leading to regulation of the transcription of downstream COR genes and activation of a series of physiological responses [16, 17]. Numerous studies have shown that NAC TFs participate in plant cold response by regulating the CBF pathway. For instance, GmNAC20 in soybean, MaNAC1 in banana, PbeNAC1 in pear, and SlNAC35 in tomato are NAC TFs that enhance plant cold tolerance by modulating the CBF-dependent pathway [12,13,15,18]. However, the specific molecular mechanisms underlying the regulation of plant cold resistance by NAC TFs through CBF-independent pathways remain elusive.Lignin is a complex, three-dimensional polyphenolic polymer with aromatic characteristics, widely distributed in nature and ranking second in organic carbon content after cellulose. Lignin constitutes about 30% of the organic carbon in the biosphere [19]. Cinnamyl alcohol dehydrogenase (CAD), a key enzyme in lignin synthesis, catalyzes the final step reaction in the specific biosynthetic pathway of lignin [20]. CAD is involved in long-distance water transport, mechanical support, and responses to stress [21]. Studies have demonstrated that CAD1 overexpression in Arabidopsis significantly increases lignin content, resulting in robust roots, vigorous seedlings, and enhanced resistance against pathogens [22]. CmCAD2/3 and CmCAD3 enhance water transport capacity and drought tolerance in melon seedlings through lignin synthesis [23]. In maize, CAD expression and lignin content are significantly positively correlated with drought resistance [24]. TaCAD12 increases cell wall mechanical strength in wheat, forming an effective physical barrier that enhances resistance against Fusarium graminearum [25]. Transient silencing of GhCAD35, GhCAD45, or GhCAD43 induces defense-related lignification in cotton stems, impairing resistance against Verticillium dahliae [26]. These findings indicate the role of CAD in modulating lignin content or composition in plants and its functions in alleviating biological stress. However, the function of CAD in modulating cold resistance has not been fully elucidated.Pepper (Capsicum annuum L.), originating from the tropical regions of the United States of America, is highly sensitive to low temperatures. Peppers grow best between 21°C and 27°C, with growth and development restricted when temperatures drop below 12 °C [27]. Research indicates that low temperatures cause wilting of pepper leaves, plant lodging, and death, ultimately affecting pepper crop productivity [28]. Therefore, ensuring robust mechanical strength and resistance to lodging is crucial in maintaining high productivity. In this study, we investigated the role of the CaNAC76-CaCAD1 signaling pathway in enhancing low-temperature tolerance using virus-induced gene silencing (VIGS) and transgenic Arabidopsis materials. The results showed that the C-terminal region of CaNAC76 has transcriptional activation activity, directly binding to the promoter region of CaCAD1 to upregulate its expression. Consequently, Overexpression of CaCAD1 can enhance Arabidopsis lignin content and cold resistance. In summary, our findings provide evidence that CaNAC76 enhances lignin content by upregulating CaCAD1 expression, thereby increasing plant cold tolerance.2 Materials and methods2.1 Plant materials and cold treatmentThis study focused on seedlings of the pepper variety "Ganzi" and Arabidopsis (ecotype Columbia-0). The experimental materials were cultured in a climate chamber under conditions of 25°C/22°C day/night temperature with a 16/8-hour light/dark cycle, and 70% relative humidity day/night. Cold treatment methods for Arabidopsis: (1) CK: control at normal temperature; (2) NA: exposure to -7°C for 3 hours followed by 4°C for 24 hours; (3) CA: exposure to 4°C for 3 days, then -10°C for 3 hours, and finally 4°C for 24 hours. Similarly, Cold treatment for pepper: (1) CK: control at normal temperature; (2) exposure to 4°C for 24 hours. After low-temperature stress, samples were taken and stored at −80 ℃ after treatment with liquid nitrogen for later use. Each treatment was replicated three times biologically. 2.2 Virus-induced gene silencing of CaNAC76 and CaCAD1 As previously described by Zhang et al. [27, 28], CaNAC76 and CaCAD1 were knocked out in pepper using VIGS. Based on SGN-VIGS (https://vigs.solgenomics.net/) predictions, we introduced 300 bp fragments of CaNAC76 and CaCAD1 into the pTRV2 vector. The plasmids pTRV1, pTRV2:CaNAC76, pTRV2:CaCAD1, pTRV2:00, and pTRV2:CaPDS were separately transformed into GV3101 strain, and the bacteria were used to infiltrate fully expanded pepper cotyledons. RT-qPCR was used to evaluate the silencing efficiency of CaNAC76 and CaCAD1 after 21 days.2.3 Subcellular localization of CaNAC76 and CaCAD1The CDS sequences of CaNAC76 and CaCAD1 were inserted into the Super-1300-GFP vector. The vectors were then transferred into GV3101 strains. Subsequently, GFP-CaNAC76 and GFP-CaCAD1 were co-infiltrated into tobacco leaves with cytoplasmic marker (RPP3A-mCherry) and nuclear marker (NLS-mCherry) suspensions at a 1:1:1 ratio. After 2 days of dark treatment, observations and imaging were performed using a laser scanning confocal microscope.2.4 Obtaining Arabidopsis overexpressing CaNAC76 gene and CaCAD1 geneTo generate Arabidopsis overexpressing CaNAC76 and CaCAD1, the CDS sequences of CaNAC76 and CaCAD1 were inserted into the PBI121 vector. The 35S:CaNAC76 and 35S:CaCAD1 constructs were then transformed into GV3101. The floral dip method was used for genetic transformation, and T3 plants were selected for further study.2.5 Measurement of physiological parametersElectrolyte permeability and chlorophyll content were assessed using the method described by Jin et al. [13]. MDA content and proline content were measured using the thiobarbituric acid (TBA) method and the sulfosalicylic acid method, respectively, as outlined by Ma et al. [15]. The SOD activity, POD activity and CAT activity were referenced from previous studies [18]. Lignin content was determined using the acetylation method. Cinnamyl alcohol dehydrogenase activity was determined using ultraviolet spectrophotometry. PAM2500 chlorophyll fluorometer, and LI-6400 portable photosynthesis system were used to measure chlorophyll fluorescence parameters and photosynthetic parameters. H2O2 and O2- were performed with DAB and NBT respectively, asdescribed by Zhang et al. [27, 28]. Lignin tissue histochemical staining was performed using the phloroglucinol staining method. Thin sections of pepper tender stems with transient silencing and tender stems of transgenic Arabidopsis were stained, and then observed and photographed under a microscope.2.6 Real-time qPCRPlant RNA Extraction Kit was used to extract total RNA from pepper and Arabidopsis leaves. A first-strand cDNA synthesis kit was used to synthesize cDNA, followed by RT-qPCR analysis using a Bio-Rad iCycleriQTM machine (Hercules, CA, USA). The Caactin2 and Atactin2 was used as a stable reference gene. The2−ΔΔCT method was used for analysis, and the primers used for RT–qPCR are listed in Table S1.2.7 Transcriptional activation analysis of CaNAC76Integrate the 5×GAL4 and 1×TATA sequences into the pGreenII0800 vector to obtain the reporter vector. Then, insert the CaNAC76 CDS into the p1300-YFP vector containing the gal4-BD domain to create the effector vector. Use p1300-BD-VP16 as the positive control and the modified p1300-BD-Empty as the negative control. Finally, co-infiltrate tobacco leaves with the 5×UAS-TATA-LUC (Upstream Activating Sequence/ Minimal TATA Promoter) containing bacterial solution and bacterial solutions containing p1300-BD-CaNAC76, the positive control, and the negative control. After dark incubation for 2 days, assess the LUC/REN ratio. Insert the CDS of CaNAC76 and two sequence fragments (1-132aa, 133-332aa) separately into the pGBKT7 vector. Then, transform the constructs into the yeast strain Y2H and incubate at 30°C for 3 days under double dropout (SD/−Ade/−His/+X-α-gal). Finally, examine and photograph the yeast plate.2.8 Low-temperature response of CaNAC76 and CaCAD1 promotersTo explore the response of CaNAC76 and CaCAD1 to low-temperature stress, we constructed CaNAC76pro-LUC, CaNAC76pro-GUS, CaCAD1pro-LUC, and CaCAD1pro-GUS vectors, which were then introduced into A. tumefaciens strain GV3101 for co-infiltration into tobacco leaves. The activities of LUC enzyme and GUS enzyme were determined according to Dual-Luciferase Reporter Gene Assay Kit (Beyotime Biotechnology, Shanghai, China) and GUS gene quantitative detection Kit (Coolaber, Beijing, China), respectively. 2.9 Y1H assay Insert the CDS of CaNAC76 into the pGADT7 vector and link the CaCAD1 promoter element (AGTAGAGTGAGAGAGAAGTAA) to the pAbAi vector. First, screen for the appropriate AbA concentration on SD/-Ura + AbA dropout media (Coolaber, Beijing, China). Then, evaluate the growth of yeast cells co-transformed with pGADT7-CaNAC76 and pAbAi-CaCAD1pro on SD/-Leu + AbA (300 ng/mL) dropout media to determine if there was a binding interaction between CaCAD1pro and CaNAC76. 2.10 Dual-LUC and EMSA assaysIn the Dual-LUC experiment, the CDS of CaNAC76 was inserted into the pGreenII 62-SK vector to construct the effector vector, and the CaCAD1 promoter was cloned into the pGreenII 0800-LUC vector to obtain the reporter vector. The reporter and effector genes were then transformed into GV3101, and these strains were co-infiltrated into tobacco leaves. After a 2-day dark treatment, in vivo imaging and measure the activities of luciferase (LUC) and Renilla (REN).The CDS of CaNAC76 was inserted into the PMAL-C5X vector. The PMAL-C5X-CaNAC76 was then transformed into BL21 (Rosseta) cells to induce protein expression. Purified MBP-CaNAC76 protein was used in EMSA binding experiments with 6-FAM labeled probe, 6-FAM labeled mutant probe, and unlabeled 5' biotin-labeled probe. For specific details, refer to the EMSA Chemiluminescent Kit (Biorun, Wuhan, China).2.11 Statistical analysisThe data were compiled with Excel 2019 (Microsoft, Redmond, WA, USA) and analyzed statistically using SPSS 23.0 with Tukey's test at P < 0.05.3 Results3.1 CaNAC76 expression is modulated by low temperature After treating two pepper varieties (‘Ganzi’ and ‘Xiansheng’) at low temperatures (0 h, 6 h, 24 h), transcriptome sequencing analysis was performed (NCBI accession number: PRJNA778231). The results showed that 56 NAC gene family members exhibited different transcription levels under low-temperature treatment (Fig. S1a). Among them, LOC107866299 showed a continuous increase in expression in the cold-tolerant variety ‘Ganzi’, while it exhibited a trend of first increasing and then decreasing in the cold-sensitive variety ‘Xiansheng’. We hypothesize that LOC107866299 plays a role in cold tolerance in pepper and named it CaNAC76 for further study. The full cDNA sequence of CaNAC76 (LOC107866299) includes an open reading frame (ORF) of 996 bp. This gene encodes a protein of 332 amino acids. Phylogenetic analysis revealed that CaNAC76 is evolutionarily related to NtNAC76 (Nicotiana tabacum L) (Fig. 1a). The amino acid sequence alignment showed that the CaNAC76 protein shares significant sequence homology with homologs from other species (Fig. S1b).Expression profiling across different tissues indicated that CaNAC76 is most highly expressed in seeds, followed by stems, while the lowest expression is found in the flesh (Fig. 1b). Under low-temperature stress, the expression of CaNAC76 initially increased and then decreased, peaking at 3 hours (Fig. 1c). Insert the native promoter of CaNAC76 into a vector containing LUC and GUS reporter genes for cold response analysis. LUC/REN ratios and GUS enzyme activity assays revealed that low-temperature treatment increased the activity of the CaNAC76 promoter (Fig. S1c, d), as shown by luminescence imaging and GUS staining (Fig. 1d, e).The results revealed that YBD-CaNAC76, co-transformed with an effector vector containing 5×UASTATA, exhibited significantly higher LUC/REN ratios compared to the pBD-empty, demonstrating the transcriptional activity of CaNAC76 (Fig. 1f).We evaluated recombinant plasmids containing specific segments using a yeast two-hybrid system to explore the location of the transcription activation region in CaNAC76. The findings demonstrated normal yeast growth when transformed with either the full-length CaNAC76 ORF sequence (1-332 aa) or the CaNAC76 C-terminal sequence (133-332 aa), whereas the CaNAC76 N-terminal sequence (1-132 aa) did not support normal growth (Fig. 1g). In summary, these results demonstrate that CaNAC76 exhibits transcriptional activation activity, with the activation region located in the C-terminal domain. Figure 1. CaNAC76 expression is modulated by low temperature. Error bars represent the standard deviation, while the lowercase letters indicate significant differences at P < 0.05. Each treatment was replicated three times biologically. (a) Phylogenetic tree of NAC76s. The red box highlights CaNAC76. (b) Relative expression levels of CaNAC76 in different pepper tissues. (c) Relative expression levels of CaNAC76 under cold stress in pepper (4oC). (d) In vivo LUC imaging of the CaNAC76 native promoter in tobacco under cold treatment (4oC for 6 h) following transient infection. LT: low temperature. (e) GUS staining of the CaNAC76 native promoter in tobacco under cold treatment (4oC for 6 h) following transient infection. (f) Transcriptional activation assay in tobacco. Positive control: YBD-VP16; Negative control: YBD-Empty. (g) Transcriptional activation domain assay of CaNAC76 in yeast. The right panel displays the different CaNAC76 fragment employed for testing. Positive control: GAL4; Negative control: PGBKT7-lam. SD: Synthetic Defined media; A: Adenine; H: Histidine. 3.2 Silencing the CaNAC76 gene reduced pepper cold resistance We assessed the function of CaNAC76 in response to low-temperature. The results showed that transient transformation for 3 weeks caused leaf whitening in TRV2: CaPDS (positive control) plants (Fig. S2a), whereas no leaf whitening was observed in TRV2:00 (negative control) or TRV2:CaNAC76 plants. Notably, the expression level of CaNAC76 in TRV2:CaNAC76 plants was 69.62% lower compared to control plants, validating the reliability of this experiment (Fig. S2b).TRV2:CaNAC76 plants showed no significant phenotypic differences compared to TRV2:00 plants under normal temperature conditions (Fig. 2a). After low-temperature (4oC) treatment, TRV2:CaNAC76 plants showed greater leaf damage than the TRV2:00 plants. This was accompanied by a notable decrease in total chlorophyll content, net photosynthetic rate, and potential photochemical efficiency (Fv/Fm), along with a significant rise in electrolyte permeability (Fig. 2b-e).Further analysis using 3,3'-diaminobenzidine (DAB) and nitroblue tetrazolium (NBT) staining showed that TRV2:CaNAC76 leaves accumulated more reactive oxygen species (H2O2 and O2-) under low temperature conditions compared to TRV2:00 plants (Fig. 2f). Quantitative measurements of H2O2 and O2- levels confirmed enhanced oxidative damage in TRV2:CaNAC76 plants subjected to cold stress (Fig. 2g, h).We further explored the anatomy of TRV2:CaNAC76 plant leaves to understand the underlying mechanism of lower photosynthetic capacity and increased ROS accumulation in the leaves of these plants. Under cold stress, TRV2:CaNAC76 plants exhibited a more loosely organized cellular arrangement, disrupted palisade tissue, and larger and less densely packed intercellular spaces in the spongy tissue (Fig. 2i). These observations indicate significant leaf damage under low-temperature conditions compared to control plants.Furthermore, we assessed the antioxidant capacity of CaNAC76-silenced plants. Under low-temperature stress, TRV2:CaNAC76 plants had significantly lower activities of SOD, POD, and CAT enzymes and proline levels compared to control plants, whereas MDA accumulation was substantially higher (Fig. S3a-e). These findings demonstrate that silencing CaNAC76 reduces antioxidant capacity, increases reactive oxygen species levels, and enhances the sensitivity of pepper plants to low temperatures. Figure 2. Silencing the CaNAC76 gene reduced pepper cold resistance. Error bars represent the standard deviation, while the lowercase letters indicate significant differences at P < 0.05. Each treatment was replicated three times biologically. (a) Phenotypes of TRV2:CaNAC76 plants and TRV2:00 plants under cold stress (4oC 24 h). (b) Total chlorophyll content. (c) Net photosynthetic rate. (d) Fv / Fm. (e) Electrolyte permeability. (f) DAB and NBT tissue staining of TRV2:CaNAC76 and TRV2:00 plants under low temperature. (g) H2O2 content. (h) O2- content. (i) Transverse sections of leaves from TRV2:CaNAC76 plants and TRV2:00 plants under low temperature. scale bars = 50 μm. SP: spongy tissue; PP: palisade tissue. (j-n) 3.3 Ectopic expression of CaNAC76 improved Arabidopsis cold toleranceTo explore its function, we ectopically overexpressed CaNAC76 in Arabidopsis thaliana, generating stable transgenic lines in the T3 generation. We selected three CaNAC76 overexpression lines (OE#4, OE#7, and OE#8), which showed significantly higher relative expression levels compared to WT Arabidopsis, for subsequent experiments (Fig. S4). CaNAC76 overexpression significantly enhanced freezing tolerance in Arabidopsis under non-acclimated (NA) and cold-acclimated (CA) conditions (Fig. 3a). Overexpression of CaNAC76 significantly increased total chlorophyll content and the activities of antioxidant enzymes (SOD, POD, and CAT) under both NA and CA conditions compared to WT plants (Fig. 3b-e). Compared to WT Arabidopsis, overexpression of CaNAC76 significantly reduced the MDA content and electrolyte permeability in Arabidopsis under low-temperature stress (Fig. 3f, g). Moreover, we observed that under NA and CA treatment, overexpression of CaNAC76 significantly upregulated the relative expression of antioxidant genes (AtSOD7, AtPOD1, and AtCAT3) in Arabidopsis, which aligns with the results of antioxidant enzyme activity (Fig. 3h-j). Furthermore, it was discovered that CaNAC76 has a potential regulatory effect on genes in the CBF regulatory network. Under NA and CA conditions, overexpression of CaNAC76 significantly increases the expression of AtICE1, AtCBF1, and AtCOR47 genes in Arabidopsis (Fig. 3k-m). In summary, CaNAC76 positively regulates Arabidopsis tolerance to freezing stress by enhancing antioxidant enzyme activity and modulating the CBF regulatory network. Figure 3. Ectopic expression of CaNAC76 improved Arabidopsis cold tolerance. Error bars represent the standard deviation, while the lowercase letters indicate significant differences at P < 0.05. Each treatment was replicated three times biologically. (a) Phenotypes of WT Arabidopsis and CaNAC76-overexpressing Arabidopsis lines (OE#4, OE#7, OE#8) under low temperature stress. (b) Total chlorophyll content. (c-e) Activity of SOD, POD, and CAT in WT Arabidopsis and CaNAC76-overexpressing Arabidopsis lines (OE#4, OE#7, OE#8). (g) MDA content. (g) Electrolyte permeability. (h-m) Relative expression levels of AtSOD7, AtPOD1, AtCAT3, AtICE1, AtCBF1 and AtCOR47 in WT Arabidopsis and CaNAC76-overexpressing Arabidopsis lines (OE#4, OE#7, OE#8). 3.4 CaNAC76 regulates lignin content in peppers and Arabidopsis Low temperature promotes the expression of lignin-related genes and lignin accumulation [18, 20]. The expression level of CaNAC76 increases under low-temperature, and we suspect that CaNAC76 is involved in lignin biosynthesis. To investigate this, we used VIGS and transgenic Arabidopsis to evaluate lignin content and elucidate the roles of CaNAC76 in lignin biosynthesis. We observed changes in lignin content in pepper plants with silenced CaNAC76 and transgenic Arabidopsis overexpressing CaNAC76. Silencing CaNAC76 decreased lignin content in pepper plants compared to control plants (Fig. 4a). Conversely, overexpression of CaNAC76 significantly increased lignin content in Arabidopsis (Fig. 4b). These results indicate that CaNAC76 enhances lignin biosynthesis. Moreover, we performed phloroglucinol staining on pepper plants’ stems with silenced CaNAC76 and Arabidopsis plants’ stems with overexpressed CaNAC76. The results revealed that the stems of pepper with silenced CaNAC76 exhibited lighter lignin staining and fewer, smaller xylem vessels compared to control plants, which limited stem thickening (Fig. 4c). Conversely, CaNAC76 overexpression in Arabidopsis increased the area and number of xylem vessels in stem sections, accompanied by deeper staining of xylem and interfascicular fibers compared to WT Arabidopsis (Fig. 4d). We further analyzed the effect of CaNAC76 on the expression levels of lignin-related genes under low-temperature treatment. The results showed that silencing CaNAC76 inhibited the expression of key lignin synthesis genes CaPAL1, CaC4H1, CaCAD1 and CaPOA1 in peppers (Fig. 4e-i). In contrast, overexpression of CaNAC76 promoted the expression levels of lignin-related biosynthetic genes AtPAL1, AtC4H1, At4CL1, AtCAD5, and AtPOD1 in Arabidopsis under both NA and CA treatments (Fig. 4j-n). These results suggest that CaNAC76 still induces lignin accumulation under low temperature, thereby enhancing the cold tolerance of peppers. Figure 4. CaNAC76 regulates lignin content in peppers and Arabidopsis. Asterisks denote statistical significance (* P < 0.05, ** P < 0.01). Error bars represent the standard deviation, while the lowercase letters indicate significant differences at P < 0.05. Each treatment was replicated three times biologically. (a) Lignin content of TRV2:CaNAC76 plants and TRV2:00 plants. (b) Lignin content of WT Arabidopsis and CaNAC76-overexpressing Arabidopsis lines (OE#4, OE#7, OE#8). (c) Phlorogliol staining of TRV2:CaNAC76 plants and TRV2:00 plants. X: xylem; P: phloem; Pi: pith. scale bars = 200 μm. (d) Phloroglucinol staining of young stems of WT Arabidopsis and CaNAC76-overexpressing Arabidopsis lines (OE#4, OE#7, OE#8). scale bars = 50 μm. X: xylem; If: interfascicular fibe. (e-i) Relative expression levels of CaPAL1, CaC4H1, Ca4CL1, CaCAD1 and CaPOD1 in CaNAC76 silenced plants and control plants under low-temperature treatment. (j-n) Relative expression levels of AtPAL1, AtC4H1, At4CL1, AtCAD5 and AtPOD1 in WT Arabidopsis and CaNAC76-overexpressing Arabidopsis lines (OE#4, OE#7, OE#8) under low-temperature treatment.3.5 CaCAD1 is a direct target gene of CaNAC76Lignin accumulation is associated with various lignin metabolism genes. We further analyzed all cis-elements in the promoter regions of PAL1, C4H1, 4CL1, CAD1 and POD1 in pepper. Based on their functional associations, we categorized them into three types: stress response elements, hormone response elements, and light response elements (Fig. S5). Among them, only the natural promoter of CaCAD1 (426-446 bp) contains a binding site for CaNAC76 (AGTAGAGTGAGAGAGAAGTAA). Therefore, we hypothesized that CaNAC76 affects lignin accumulation by regulating the expression of CaCAD1.We determined the subcellular localization of CaNAC76 and CaCAD1 by co-expressing GFP-CaNAC76 and GFP-CaCAD1 fusion proteins with cytoplasmic (RPP3A-mCherry) and nuclear markers (NLS-mCherry) in tobacco leaves. Confocal microscopy observation showed that GFP-CaNAC76 and GFP-CaCAD1 were localized in the nucleus and cytoplasm (Fig.6a). We first performed the yeast one-hybrid (Y1H) assay to validate the interaction between CaNAC76 and CaCAD1. The results showed that yeast cells co-transformed with pGADT7-CaNAC76 and pAbAi-CaCAD1pro grew normally on SD/-Leu + AbA (300 ng/mL) dropout media, indicating an interaction between CaNAC76 and the CaCAD1 promoter region (Fig. 5b). Furthermore, EMSA experiments showed binding of CaNAC76 to the NAC binding site in the CaCAD1 promoter region (Fig. 5c). Dual luciferase reporter assays revealed that LUC/REN ratios was significantly higher in tobacco leaves expressing 35S::CaNAC76 and CaCAD1pro::LUC compared to those injected with 35S::empty and CaCAD1pro::LUC, indicating that CaNAC76 upregulated CaCAD1 promoter transcription (Fig. 5d). The in vivo imaging results of plant luciferase are consistent with the LUC/REN ratios (Fig. 5e).Finally, we measured CAD enzyme activity in pepper plants with silenced CaNAC76 and Arabidopsis plants overexpressing CaNAC76. The results showed that reduced expression of CaNAC76 inhibited the expression level of CaCAD1 and CAD enzyme activity (Fig. 5f, g), while overexpression of CaNAC76 increased CAD enzyme activity (Fig. 5h), consistent with the results from the Dual-LUC assay (Fig. 5d, e). Figure 5. CaCAD1 is a direct target gene of CaNAC76. (a) Subcellular localization results of CaNAC76 and CaCAD1; scale bars = 10 μm. (b) Y1H results show the interaction between CaNAC76 and the CaCAD1 promoter. Positive control: Pabai-53+PAGDT7-53; negative control: Pabai-P+PAGDT7-lam; Experimental group: Pabai-CaCAD1pro+PAGDT7-CaNA76. (c) EMSA showing that CaNAC76 can bind to the promoter elements of CaCAD1. From left to right: 6-FAM labeled prope; CaNAC76 and 6-FAM labeled probe; CaNAC76, 6-FAM labeled probe and 10x unlabeled probe; CaNAC76, 6-FAM labeled probe and 20x unlabeled probe; CaNAC76, 6-FAM labeled probe and 50x unlabeled probe; CaNAC76 and 6-FAM labeled mutant probe. (d) LUC/REN ratios. E: Effector vector; R: Reporter vector. (e) Dual-luciferase in vivo imaging assay results. E: Effector vector; R: Reporter vector. (f) The expression level of CaCAD1 in TRV2:CaNAC76 plants and TRV2:00 plants. (g) CAD activity of TRV2:CaNAC76 plants and TRV2:00 plants. (h) CAD activity of WT Arabidopsis and CaNAC76-overexpressing Arabidopsis lines (OE#4, OE#7, OE#8). Asterisks denote statistical significance (* P < 0.05, ** P < 0.01).3.6 CaCAD1 expression is affected by low temperature The CDS sequence of CaCAD1 (LOC107851230) contains an ORF of 1005 bp in length, which encodes a protein composed of 335 amino acids. Phylogenetic analysis indicated that CaCAD1 shares an evolutionary relationship with SICAD1 (Solanum lycopersicum) (Fig. 6a, Fig. S6a). Expression profiling across various tissues revealed that CaCAD1 was predominantly expressed in the carpopodium, followed by seeds and stems, with the lowest expression observed in the flesh (Fig. 6b). Notably, CaCAD1 expression significantly increased under low-temperature conditions, reaching its peak at 24 hours (Fig. 6c).We conducted further analysis to explore the CaCAD1 native promoter (Promoter sequence in supplementary data) response to low temperatures. Tobacco leaves administered with CaCAD1pro::LUC exhibited higher fluorescence intensity after 6 hours at 4 °C (Fig. 6d), whereas leaves treated with CaCAD1pro::GUS displayed deeper staining after 6 hours at 4 °C (Fig. 6e). Similarly, CaCAD1pro::LUC and CaCAD1pro::GUS showed higher LUC/REN ratio and GUS enzyme activity under low-temperature conditions (Fig. S6b, c), indicating that the CaCAD1 promoter responds to low temperatures. Figure 6. CaCAD1 expression is affected by low temperature. Error bars represent the standard deviation, while the lowercase letters indicate significant differences at P < 0.05. Each treatment was replicated three times biologically. (a) Phylogenetic tree of CAD1s. The red box highlights CaCAD1. (b) Relative expression levels of CaCAD1 in different pepper tissues. (c) Relative expression levels of CaCAD1 under cold stress in pepper (4oC). (d) In vivo LUC imaging of the CaCAD1 native promoter in tobacco under cold treatment (4oC for 6 h) following transient infection. (e) GUS staining of the CaCAD1 native promoter in tobacco under cold treatment (4oC for 6 h) following transient infection.3.7 Silencing the CaCAD1 gene reduced pepper cold resistance We conducted preliminary studies on the function of CaCAD1 under low-temperature conditions in pepper using VIGS experiments. RT-qPCR analysis revealed a significant reduction on CaCAD1 expression in TRV2:CaCAD1 plants by 67.62% compared to control plants (Fig. S7), validating the reliability of the experiment.Under normal conditions, no apparent phenotypic differences existed between TRV2:CaCAD1 and TRV2:00 plants. However, after cold stress, TRV2:CaCAD1 displayed more severe leaf wilting than TRV2:00 plants (Fig. 7a). This was characterized by a notable decrease in total chlorophyll content, net photosynthetic rate, and potential photochemical efficiency (Fv / Fm), as well as a significant increase in electrolyte permeability compared to the control plants (Fig. 7b-e).DAB and NBT staining revealed more brown and blue staining spots in TRV2:CaCAD1 leaves under cold conditions compared to control plants (Fig. 7f), which was consistent with the results on H2O2 and O2- levels (Fig. 7g, h).Further anatomical analysis of TRV2:CaCAD1 leaves under cold stress revealed larger intercellular spaces between palisade and spongy tissues, as well as disorganized tissue arrangement (Fig. 7i), indicating severe leaf damage under cold stress. In addition, we assessed the antioxidant capacity of TRV2:CaCAD1 plants. After 24-hour treatment at 4 °C, TRV2:CaCAD1 plants exhibited significantly lower activities of SOD, POD, CAT, reduced proline content, and higher MDA levels compared to control plants (Fig.S8 a-e). These results demonstrate that silencing CaCAD1 reduces antioxidant capacity and increases ROS levels in pepper plants, ultimately reducing tolerance to low temperatures. Figure 7. Silencing the CaCAD1 gene reduced pepper cold resistance. Error bars represent the standard deviation, while the lowercase letters indicate significant differences at P < 0.05. Each treatment was replicated three times biologically. (a) Phenotypes of TRV2:CaCAD1 plants and TRV2:00 plants under cold stress. (b) Total chlorophyll content. (c) Net photosynthetic rate. (d) Fv / Fm. (e) Electrolyte permeability. (f) DAB and NBT tissue staining of TRV2:CaCAD1 and TRV2:00 plants under low temperature. (g) H2O2 content. (h) O2- content. (i) Transverse sections of leaves from TRV2:CaCAD1 plants and TRV2:00 plants. scale bars = 50 μm. SP: spongy tissue; PP: palisade tissue. (j-n) SOD activity, POD activity, CAT activity, proline content, and MDA content in TRV2:CaCAD1 and TRV2:00 plants under low temperature. Asterisks denote statistical significance (* P < 0.05, ** P < 0.01).3.8 Ectopic expression of CaCAD1 improved Arabidopsis cold tolerance We further conducted stable overexpression of CaCAD1 in Arabidopsis thaliana T3 lines to confirm the function of this gene. Using RT-qPCR, we identified three lines out of twelve T3 lines for freezing tolerance assays (Fig. S9). Under NA and CA conditions, CaCAD1 overexpression in Arabidopsis significantly enhanced freezing tolerance compared to WT Arabidopsis (Fig. 8a). Moreover, CaCAD1 overexpression significantly increased total chlorophyll content and activities of antioxidative enzymes (SOD, POD, and CAT) under NA and CA conditions (Fig. 8b-e). Conversely, CaCAD1 overexpression significantly reduced MDA content and electrolyte permeability compared to WT Arabidopsis (Fig. 8f, g). Furthermore, we assessed the AtSOD7, AtPOD1, and AtCAT3 expression levels in Arabidopsis under NA and CA conditions. The results demonstrated that CaCAD1 overexpression significantly upregulated the expression levels of the three genes (Fig. 8h-j). These results demonstrate that CaCAD1 enhances freezing tolerance in Arabidopsis. Figure 8. Ectopic expression of CaCAD1 improved Arabidopsis cold tolerance. Error bars represent the standard deviation, while the lowercase letters indicate significant differences at P < 0.05. Each treatment was replicated three times biologically. (a) Phenotypes of WT Arabidopsis and CaCAD1-overexpressing Arabidopsis lines (OE#3, OE#7, OE#11) under low temperature stress. (b) Total chlorophyll content. (c-e) Activity of SOD, POD, and CAT in WT Arabidopsis and CaCAD1-overexpressing Arabidopsis lines (OE#3, OE#7, OE#11). (f) Electrolyte permeability. (g) MDA content. (h-j) Relative expression levels of AtSOD, AtPOD and AtCAT in WT Arabidopsis and CaCAD1-overexpressing Arabidopsis lines (OE#3, OE#7, OE#11).4 DiscussionThe increasing frequency of extreme low temperatures due to global climate change severely limits the growth, development, and yields of peppers. Plants have evolved complex response mechanisms involving various genes that encode structural and regulatory proteins, playing essential roles in protecting plants against cold stress [29-31]. NAC TFs modulate plant stress responses, including cold tolerance. However, the specific functions and mechanisms of NAC TFs in pepper under low-temperature stress remain unclear. In this study, we isolated a cold-induced NAC TF, CaNAC76, featuring a highly conserved N-terminal NAM (No Apical Meristem) domain. Overexpression of CaNAC76 enhances the antioxidant capacity and cold tolerance of Arabidopsis. Conversely, silencing CaNAC76 reduces the antioxidant capacity of pepper, leading to a cold-sensitive phenotype. Furthermore, we discovered that CaNAC76 interacts with the CaCAD1 promoter, leading to elevated CaCAD1 transcript levels and increased lignin accumulation, which in turn boosts pepper cold tolerance. These findings offer valuable insights for the molecular breeding of peppers.During cold stress, ROS accumulate excessively in plant cells, resulting in oxidative stress and damage to various components [32]. In this study, we identified CaNAC76, a stress-responsive transcription factor that enhances cold stress tolerance. Promoter activity analysis revealed that the activity of CaNAC76 promoter was significantly enhanced under cold conditions (Fig. 1d, e). Moreover, we silenced CaNAC76 in peppers and overexpressed it in Arabidopsis to elucidate the function of CaNAC76. The findings indicated that CaNAC76-silenced plants exhibited higher sensitivity to low temperatures compared to control plants (Fig. 2a). Conversely, Arabidopsis overexpressing CaNAC76 exhibited increased cold tolerance. Under cold conditions, CaNAC76-silenced plants had higher levels of O2- and H2O2 (Fig. 2g, h), as confirmed by DAB and NBT staining, which showed darker staining spots on the leaves of CaNAC76-silenced plants under low temperatures (Fig. 2f). Conversely, CaNAC76-overexpressing Arabidopsis lines demonstrated reduced membrane lipid peroxidation under cold stress, resulting in less leaf damage (Fig. 3f, g). ROS accumulation under low-temperature stress damages Photosystem II (PSII) and decreases chlorophyll content [33]. Under low-temperature stress, the net photosynthetic rate and chlorophyll content were lower in TRV2:CaNAC76 plants than in TRV2:00 plants (Fig. 2b, c). On the contrary, chlorophyll content significantly increased in OE-CaNAC76 Arabidopsis compared to WT Arabidopsis (Fig. 3b). There are physiological indicators of membrane integrity, including MDA content and electrolyte permeability, that can indicate cellular damage in plants [30,32]. Therefore, we evaluated the MDA content and electrolyte permeability to assess the role of CaNAC76 in membrane damage under low-temperature conditions. Under cold stress, OE-CaNAC76 lines exhibited lower MDA content and electrolyte permeability than WT Arabidopsis (Fig. 3f, g). In contrast, MDA content and electrolyte permeability were significantly higher in CaNAC76-silenced plants compared to control plants (Fig. 2e, Fig. S3e). These results indicate that CaNAC76 reduces ROS levels under cold stress, thereby alleviating cold-induced plant damage.Plants have evolved complex physiological responses to cope with cold stress to eliminate and reduce ROS levels, including enhancing antioxidant enzyme activities and accumulating osmotic regulators [13, 32]. Under low-temperature stress conditions, CaNAC76-silenced plants exhibited lower activities of SOD, POD, and CAT enzymes than in control plants (Fig. S3a-c). Conversely, the activities of these enzymes were significantly higher in OE-CaNAC76 Arabidopsis lines than in WT Arabidopsis (Fig. 3c-e). Proline accumulation can enhance plant cold tolerance [34]. The proline content in TRV2:CaNAC76 plants was significantly lower than in TRV2:00 plants under low-temperature stress (Fig. S3d). Furthermore, CaNAC76 overexpression significantly upregulated the expression of AtSOD7, AtPOD1, and AtCAT3 under NA and CA treatments (Fig. 3h-j). These results indicate that CaNAC76 enhances plant cold tolerance by activating the ROS scavenging system and inducing the accumulation of osmotic regulators.NAC TFs represent one of the most prominent transcription factor families involved in regulating cold tolerance in plants. These TFs directly bind to NAC motifs in the promoter regions of downstream stress-related genes, upregulating or downregulating the expression of target genes [35]. For instance, GmNAC20 directly binds to the promoter regions of DREB1A/CBF3 and DREB1/CBF2 to mediate transgenic Arabidopsis resistance [12]. MaNAC1, a target gene of MaICE1, interacts with MaCBF1 to enhance cold tolerance in banana plants synergistically [36]. PbeNAC1 interacts with PbeDREB1 and PbeDREB2A to induce the transcription of cold stress-related genes, thereby enhancing cold tolerance in transgenic tobacco [13]. In this study, we found that CaNAC76 can upregulate the expression of ICE-CBF-COR genes under low-temperature conditions in Arabidopsis (Fig. 3k-m). Additionally, we observed that the C-terminal region (133-332 aa) of CaNAC76 has transcriptional activation activity (Fig. 1f, g). The Y1H, LUC/REN ratios, and EMSA results revealed that CaNAC76 directly binds to the NAC element in the promoter region of CaCAD1, thereby upregulating CaCAD1 expression (Fig. 5b-d). We propose that CaNAC76 enhances plant cold tolerance by increasing CAD activity.Previous studies have demonstrated that CAD enhances defense against various pathogens, drought, heavy metals, and ROS stress [22, 24]. However, the specific mechanisms underlying the role of CAD in increasing plant resistance against low temperatures remain unclear. In this study, we demonstrated that CaCAD1 is directly induced by low temperatures. Notably, CaCAD1-silenced plants exhibited higher H2O2 and O2- levels under low-temperature conditions, indicating increased oxidative damage (Fig. 7g, h). Conversely, OE-CaCAD1 Arabidopsis plants showed reduced lipid peroxidation levels and higher antioxidant enzyme activities than WT plants. These findings highlight that CaCAD1 enhances plant response to low-temperature stress. Furthermore, CAD is a key enzyme in lignin synthesis, significantly increasing lignin content [24]. Activation of CAD typically promotes lignin accumulation, ultimately enhancing plant resilience [37, 38]. Lignin accumulation improves cell wall integrity and water transport capacity, enhancing resistance against external stresses [39, 40]. In this study, we explored the function of CaNAC76 in lignin synthesis. Transient silencing of CaNAC76 decreased CAD activity and lignin content in pepper plants (Fig. 4a, Fig. 5f). Conversely, heterologous overexpression of CaNAC76 significantly increased CAD activity and lignin content in Arabidopsis (Fig. 4b, Fig. 5g), with more intense purple staining observed in xylem and interfascicular fibers using phloroglucinol staining (Fig. 4d). Under low-temperature treatment, overexpression of CaNAC76 still promoted the expression of lignin synthesis genes (AtPAL1, AtC4H1, At4CL1, AtCAD5, and AtPOD1) in Arabidopsis (Fig. 4j-n). These results further indicate that CaNAC76 improves plant cold tolerance by boosting the lignin accumulation through upregulating CaCAD1 expression.5 ConclusionIn this study, we propose a model where the CaNAC76-CaCAD1 module enhances cold tolerance in pepper by increasing antioxidant capacity and lignin content. The major findings were: (i) Low temperatures induce CaNAC76, and increasing the expression level of CaNAC76 can enhance cold tolerance in Arabidopsis by upregulating the expression of cold stress-responsive genes (ICE-CBF-COR) and increasing antioxidant enzyme activity; (ii) CaNAC76 directly targets and upregulates CaCAD1 expression, causing increased lignin accumulation by enhancing CAD activity. (iii) CaCAD1 can positively regulate the cold tolerance of Arabidopsis by enhancing antioxidant capacity and lignification levels. These results indicate that CaNAC76 enhances plant cold tolerance by increasing the expression of cold-induced genes (ICE-CBF-COR), boosting antioxidant capacity, and promoting lignin accumulation. Figure 9. A model was proposed in which CaNAC76 enhances pepper's cold tolerance by directly regulating the expression of CaCAD1.AcknowledgmentsThis research was supported by the vegetable breeding project (2021YFYZ0022).CRediT authorship contribution statement Jiachang Xiao: Writing – review & editing, Writing – original draft, Formal analysis, Data curation. Xiyu Sui: Data curation.: Zeping Xu: Data curation. Le Liang: Data curation. Wen Tang: Data curation. Yi Tang: Investigation. Yunsong Lai: Investigation. Bo Sun: Data curation. Zhi Huang: Methodology. Yangxia Zheng: Methodology. Huanxiu Li: Conceptualization, Funding acquisition, Writing – review & editing.Declaration of competing interestThere are no conflicts of interest to declare for authors.Data availability statementThe data are presented within the paper and supplementary files.REFERENCES[1] V. Chinnusamy, J. Zhu, J.K. Zhu, Cold stress regulation of gene expression in plants, Trends Plant Sci. 12 (2007) 444-51. https://doi.org/10.1016/j.tplants.2007.07.002[2] S. Kidokoro, K. Shinozaki, K. Yamaguchi-Shinozaki, Transcriptional regulatory network of plant cold-stress responses, Trends Plant Sci. 27 (2022) 922-935. https://doi.org/10.1016/j.tplants.2022.01.008[3] S. Gusain, S. Joshi, R. Joshi, Sensing, signalling, and regulatory mechanism of cold-stress tolerance in plants, Plant Physiol Biochem. 197 (2023) 107646. https://doi.org/10.1016/j.plaphy.2023.107646[4] W. Xie, Q. Tang, F. Yan, Transcriptional memory and response to adverse temperatures in plants, Zhejiang Univ Sci B. 22(10) (2021) 791-804. https://doi.org/10.1631/jzus.B2100287[5] Y. Shi, Y. Ding, S. Yang, Molecular Regulation of CBF Signaling in Cold Acclimation, Trends Plant Sci. 23(7) (2018) 623-637. https://doi.org/10.1016/j.tplants.2018.04.002[6] S. Gilmour, D. Zarka, E. Stockinger, Low temperature regulation of the Arabidopsis CBF family of AP2 transcriptional activators as an early step in cold-induced COR gene expression, Plant J. 16(4) (1998) 433-42. https://doi.org/10.1046/j.1365-313x.1998.00310.x[7] Y. Shi, J. Huang, T. Sun, X. Wang, C. Zhu, Y. Ai, H. Gu. The precise regulation of different COR genes by individual CBF transcription factors in Arabidopsis thaliana, J Integr Plant Biol. 59 (2) (2017) 118-133. https://doi.org/10.1111/jipb.12515[8] K. Singh, R. Foley, L. Oñate-Sánchez, Transcription factors in plant defense and stress responses, Curr Opin Plant Biol. 5(5) (2002) 430-6. https://doi.org/10.1016/S1369-5266(02)00289-3[9] S. Kidokoro, K. Yoneda, H. Takasaki, Different Cold-Signaling Pathways Function in the Responses to Rapid and Gradual Decreases in Temperature, Plant Cell. 29(4) (2017) 760-774. https://doi.org/10.1105/tpc.16.00669[10] P. Diao, C. Chen, Y. Zhang, The role of NAC transcription factor in plant cold response, Plant Signal Behav. 15(9) (2020) 1785668. https://doi.org/10.1080/15592324.2020.1785668[11] Y. Ding, Y. Shi, S. Yang, Molecular Regulation of Plant Responses to Environmental Temperatures, Mol Plant. 13(4) (2020) 544-564. https://doi.org/10.1016/j.molp.2020.02.004[12] Y. Hao, W. Wei, Q. Song, Soybean NAC transcription factors promote abiotic stress tolerance and lateral root formation in transgenic plants, Plant J. 68(2) (2011) 302-13. https://doi.org/10.1111/j.1365-313X.2011.04687.x[13] C. Jin, K. Li, X. Xu, A Novel NAC Transcription Factor, PbeNAC1, of Pyrus betulifolia Confers Cold and Drought Tolerance via Interacting with PbeDREBs and Activating the Expression of Stress-Responsive Genes, Front Plant Sci. 8 (2017) 1049. https://doi.org/10.3389/fpls.2017.01049[14] G. Le-Hénanff, C. Profizi, B. Courteaux, Grapevine NAC1 transcription factor as a convergent node in developmental processes, abiotic stresses, and necrotrophic/biotrophic pathogen tolerance, J Exp Bot. 64(16) (2013) 4877-93. https://doi.org/10.1093/jxb/ert277[15] N. Ma, Y. Zuo, X. Liang, The multiple stress-responsive transcription factor SlNAC1 improves the chilling tolerance of tomato, Physiol Plant. 149(4) (2013) 474-86. https://doi.org/10.1111/ppl.12049[16] C. Zhao, Z. Zhang, S. Xie, Mutational Evidence for the Critical Role of CBF Transcription Factors in Cold Acclimation in Arabidopsis, Plant Physiol. 171(4) (2016) 2744-59. https://doi.org/10.1104/pp.16.00533[17] Y. Jia, Y. Ding, Y. Shi, The cbfs triple mutants reveal the essential functions of CBFs in cold acclimation and allow the definition of CBF regulons in Arabidopsis, New Phytol. 212(2) (2016) 345-53. https://doi.org/10.1111/nph.14088[18] Q. Yin, W. Qin, Z. Zhou, Banana MaNAC1 activates secondary cell wall cellulose biosynthesis to enhance chilling resistance in fruit, Plant Biotechnol J. 22(2) (2023) 413-426. https://doi.org/10.1111/pbi.14195[19] W. Boerjan, J. Ralph, M. Baucher, Lignin Biosynthesis, Annu Rev Plant Biol. 54 (2003) 519-46. https://doi.org/10.1146/annurev.arplant.54.031902.134938[20] N. Chao, S. Huang, X. Kang, K. Yidilisi, M. Dai, L. Liu. Systematic functional characterization of cinnamyl alcohol dehydrogenase family members revealed their functional divergence in lignin biosynthesis and stress responses in mulberry. Plant Physiol Biochem. 186 (2022) 145-156. https://doi.org/10.1016/j.plaphy.2022.07.008[21] M. Preisner, W. Wojtasik, K. Kostyn, A. Boba, T. Czuj, J. Szopa, A. Kulma. The cinnamyl alcohol dehydrogenase family in flax: Differentiation during plant growth and under stress conditions. J Plant Physiol. 221 (2018) 132-143. https://doi.org/10.1016/j.jplph.2017.11.015[22] S. Jiang, X. Tian, X. Huang, Physcomitrium patens CAD1 has distinct roles in growth and resistance to biotic stress, BMC Plant Biol. 22(1) (2022) 518. https://doi.org/10.1186/s12870-022-03892-3[23] W. Liu, Y. Jiang, C. Wang, Lignin synthesized by CmCAD2 and CmCAD3 in oriental melon (Cucumis melo L.) seedlings contributes to drought tolerance. Plant Mol Biol. 103(6) (2020) 689-704. https://doi.org/10.1007/s11103-020-01018-7[24] Y. Hu, W. Li, Y. Xu, Differential expression of candidate genes for lignin biosynthesis under drought stress in maize leaves, J Appl Genet. 50(3) (2009) 213-23. https://doi.org/10.1007/BF03195675[25] W. Rong, M. Luo, T. Shan, A Wheat Cinnamyl Alcohol Dehydrogenase TaCAD12 Contributes to Host Resistance to the Sharp Eyespot Disease, Front Plant Sci. 7 (2016) 1723. https://doi.org/10.3389/fpls.2016.01723[26] H. Li, S. Zhang, Y. Zhao, Identification and Characterization of Cinnamyl Alcohol Dehydrogenase Encoding Genes Involved in Lignin Biosynthesis and Resistance to Verticillium dahliae in Upland Cotton (Gossypium hirsutum L.), Front Plant Sci. 13 (2022) 840397. https://doi.org/10.3389/fpls.2022.840397[27] H. Zhang, J. Guo, X. Chen, Pepper bHLH transcription factor CabHLH035 contributes to salt tolerance by modulating ion homeostasis and proline biosynthesis, Hortic Res. 9 (2022) uhac203. https://doi.org/10.1093/hr/uhac203[28] H. Zhang, Y. Pei, F. Zhu, CaSnRK2.4-mediated phosphorylation of CaNAC035 regulates abscisic acid synthesis in pepper (Capsicum annuum L.) responding to cold stress, Plant J. 117(5) (2023) 1377-1391. https://doi.org/10.1111/tpj.16568[29] Y. Yan, S. Mintao, M. Si, Mechanism of CsGPA1 in regulating cold tolerance of cucumber, Hortic Res. 9 (2022) uhac109. https://doi.org/10.1093/hr/uhac109[30] Y. Ding, S.Yang, Surviving and thriving: How plants perceive and respond to temperature stress, Dev Cell. 57(8) (2022) 947-958. https://doi.org/10.1016/j.devcel.2022.03.010 [31] X. Wang, Y. Ding, Z. Li, PUB25 and PUB26 Promote Plant Freezing Tolerance by Degrading the Cold Signaling Negative Regulator MYB15, Dev Cell. 51(2) (2019) 222-235.e5. https://doi.org/10.1016/j.devcel.2019.08.008[32] R. Gómez, P. Vicino, N. Carrillo, Manipulation of oxidative stress responsesas a strategy to generate stress-tolerant crops. From damage to signaling to tolerance, Crit Rev Biotechnol. 39 (2019) 693-708. https://doi.org/10.1080/07388551.2019.1597829[33] Y. Wei, H. Chen, L. Wang, Cold acclimation alleviates cold stress-induced PSII inhibition and oxidative damage in tobacco leaves, Plant Signal Behav. 17(1) (2021) 2013638. https://doi.org/10.1080/15592324.2021.2013638[34] S. Agurla, S. Gahir, S. Munemasa, Mechanism of Stomatal Closure in Plants Exposed to Drought and Cold Stress, Adv Exp Med Biol. 1081 (2018) 215-232. https://link.springer.com/chapter/10.1007/978-981-13-1244-1_12  [35] Q. Yin, W. Qin, Z. Zhou, Banana MaNAC1 activates secondary cell wall cellulose biosynthesis to enhance chilling resistance in fruit, Plant Biotechnol J. 22(2) (2023) 413-426. https://doi.org/10.1111/pbi.14195 [36] W. Shan, J. Kuang, W. Lu, Banana fruit NAC transcription factor MaNAC1 is a direct target of MaICE1 and involved in cold stress through interacting with MaCBF1, Plant Cell Environ. 37(9) (2014) 2116-27. https://doi.org/10.1111/pce.12303[37] Y. Kim, J. Bae, G. Huh, Transcriptional regulation of the cinnamyl alcohol dehydrogenase gene from sweet potato in response to plant developmental stage and environmental stress, Plant Cell Rep. 29(7) (2010) 779-91. https://doi.org/10.1007/s00299-010-0864-2[38] A. Boudet, S. Kajita, J. Grima-Pettenati, Lignins and lignocellulosics: a better control of synthesis for new and improved uses, Trends Plant Sci. 8(12) (2003) 576-81. https://doi.org/10.1016/j.tplants.2003.10.001[39] M. Li, C. Cheng, X. Zhang, S. Zhou, L. Li, S. Yang. Overexpression of Pear (Pyrus pyrifolia) CAD2 in Tomato Affects Lignin Content. Molecules. 24 (14) (2019) 2595. https://www.mdpi.com/1420-3049/24/14/2595[40] Q. Zhao. Lignification: Flexibility, Biosynthesis and Regulation. Trends Plant Sci. 21 (8) (2016) 713-721. https://doi.org/10.1016/j.tplants.2016.04.006