Analysis of OXP1 transcript level in CsGGCT2;1overexpression lines
WT and CsGGCT2;1 OE lines were grown for 21 days on ½ x MS and ½ x MS media supplemented with AsIII (20 µM). After RNA isolation and cDNA synthesis, qRT-PCR was performed using CsOXP1 forward (5’ GTCTTCTGCGTTGACACCCA 3’) and reverse primers (5’ GGTGCCAAGCCTCCATCAGA 3’). CsEF1 (housekeeping) primers and qRT-PCR conditions were the same as mentioned earlier.