Sequencing library preparation
Metabarcoding sequencing libraries were prepared from each pool using a two-step amplicon protocol (D’Aloia, Bogdanowicz, Harrison, & Buston, 2017) in which an initial 34-cycle PCR targets the gene region of interest using locus-specific primers with Nextera 5’ tails (5’-TC GTCGGCAGCGTCAGATGTGTATAAGAGACAG appended to each forward primer and 5’ -GTCTCGTGGGCTC GGAGATGTGTATAAGAGACAG to each reverse primer, full reaction details in the Supporting information). Equal volumes of the locus-specific PCR products for each sample were then pooled and a second 5-cycle PCR further amplified the product and added Nextera-style sequencing adapters with unique i5 and i7 indexes that allow sequencing reads to be assigned to samples during analysis (details about reagent concentrations and PCR conditions in the SI). Rather than using combinatorial indexing, which can lead to mis-assigned reads caused by index-swapping (Carøe & Bohmann, 2020; Schnell, Bohmann, & Gilbert, 2015), we used custom-synthesized adapters with unique dual indexes (Table S1) that can unequivocally identify samples by 8-base indexes on both ends of the molecule. For the initial screening with the FR and VR pools, 16 of the markers were amplified in individual PCRs and six of the markers were duplexed in three reactions – each with two markers. Duplexed markers amplified fragments from different barcoding genes with >75 bp between expected amplicon sizes, which allowed for visualization of two bands, one for each marker, on an agarose gel (see Supporting Information for details). For each sample, PCR products for all markers were pooled into a single indexed library. Three individually indexed PCR replicates were performed for each of the three replicate FR and VR DNA pools, for nine total replicates per DNA pool (the experimental design is illustrated in Fig. S1). The experimental feeds and fishmeal species DNA pools were only analysed with the top four markers (see results), each amplified in a separate PCR. Three individually indexed PCR replicates were performed for each of two DNA extracts from an experimental feed, resulting in six replicates per experimental feed (see SI, Fig. S1 for schematic). One negative control (no template) was included for every 14 PCR reactions and extraction blanks and negative library preparation controls were carried through to sequencing.
Following the indexing PCRs, all libraries were pooled in equal volume, cleaned using 1.8x AMPure XP beads (Beckman Coulter), and then eluted with 50 ul 10 uM Tris-HCl pH 8. A 2% agarose gel was used to confirm that the indexing PCR was successful based on a size shift after the addition of indexes and adapters (~130 additional bases) when compared to pooled non-indexed samples. The libraries were sequenced using paired-end 150-bp on one lane of a HiSeq X Ten (Novogene, Inc.) with 15% PhiX to account for moderately low library complexity (following Aizpurua et al., 2018).