2.6 minigene transcription analysis
Extract total RNA from cell samples according to the instructions of the kit. After concentration determination, cDNA synthesis was performed with the same amount of RNA. Reverse Transcription (RT-PCR) was carried out with primers ( the forward primer: CTAGAGAACCCACTGCTTAC; the reverse primer TAGAAGGCACAGTCGAGG; The primers were the same in the pcMINI- DMD -wt/mut or pcMINI-C- DMD -wt/mut). Total RNA was reverse-transcribed using the PrimeScript™ RT reagent Kit (Yeasen company, Shanghai, China) to generate the minigene constructs for analysis. The size of gene transcription band was detected by agarose gel and sequenced.