2.6 minigene transcription analysis
Extract total RNA from cell samples according to the instructions of the
kit. After concentration determination, cDNA synthesis was performed
with the same amount of RNA. Reverse Transcription (RT-PCR) was carried
out with primers ( the forward primer: CTAGAGAACCCACTGCTTAC; the
reverse primer TAGAAGGCACAGTCGAGG; The primers were the same in the
pcMINI- DMD -wt/mut or pcMINI-C- DMD -wt/mut). Total RNA was
reverse-transcribed using the PrimeScript™ RT reagent Kit (Yeasen
company, Shanghai, China) to generate the minigene constructs for
analysis. The size of gene transcription band was detected by agarose
gel and sequenced.