Cloning of TaHsfA6b cDNA into binary vector for over-expression and sub-cellular localization
For transformation and over-expression studies, 1396 bp long full length cDNA of TaHSFA6b along 5’ and 3’ UTR (Gen Bank acc. No. KF061193, Chauhan et al 2013) was cloned in binary vector pANIC6B (Mann et al, 2011) through GatewayTM methodology. For subcellular localization, the ORF of TaHSFA6b without its stop codon was PCR-amplified by using primer pairsorfTaHSFA6b-F- GGGGACAAGTTTGTACAAAAAAGCAGGCTATGGACCGGGTGCTGCTGC andorfTaHSFA6b-R -GGACCACTTTGTACAAGAAAGCTGGGTACGCGTCGACATATCTAGATCTCCTCC and cloned into pDONR221 and subsequently into binary vectorpB7FWG2 by GatewayTM cloning to constructpB7FWG2:35S:TaHSFA6b-GFP . The cloned sequence was verified by sequencing.